ID: 953568385

View in Genome Browser
Species Human (GRCh38)
Location 3:44052225-44052247
Sequence GAAGGAACTTCAGCCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953568380_953568385 -4 Left 953568380 3:44052206-44052228 CCAGAGTCCGGGCCTCCTGGAAG No data
Right 953568385 3:44052225-44052247 GAAGGAACTTCAGCCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953568385 Original CRISPR GAAGGAACTTCAGCCAGTGC AGG Intergenic
No off target data available for this crispr