ID: 953570065

View in Genome Browser
Species Human (GRCh38)
Location 3:44064257-44064279
Sequence CTCAACTAGAAGTTGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953570065_953570072 30 Left 953570065 3:44064257-44064279 CCATAGTCCAACTTCTAGTTGAG No data
Right 953570072 3:44064310-44064332 TAGAGAATCAGTGTAAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953570065 Original CRISPR CTCAACTAGAAGTTGGACTA TGG (reversed) Intergenic
No off target data available for this crispr