ID: 953570407

View in Genome Browser
Species Human (GRCh38)
Location 3:44067048-44067070
Sequence GCACCAGGAGACCCGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953570401_953570407 10 Left 953570401 3:44067015-44067037 CCTCCTGATGATGAATGAGTAAG No data
Right 953570407 3:44067048-44067070 GCACCAGGAGACCCGGGTGAAGG No data
953570400_953570407 17 Left 953570400 3:44067008-44067030 CCTCAGGCCTCCTGATGATGAAT No data
Right 953570407 3:44067048-44067070 GCACCAGGAGACCCGGGTGAAGG No data
953570402_953570407 7 Left 953570402 3:44067018-44067040 CCTGATGATGAATGAGTAAGTGT No data
Right 953570407 3:44067048-44067070 GCACCAGGAGACCCGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953570407 Original CRISPR GCACCAGGAGACCCGGGTGA AGG Intergenic
No off target data available for this crispr