ID: 953574330

View in Genome Browser
Species Human (GRCh38)
Location 3:44101035-44101057
Sequence CCCTGAAGACGCCTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953574320_953574330 11 Left 953574320 3:44101001-44101023 CCTGCCTGCCTGTGAGGAAAGGA No data
Right 953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG No data
953574322_953574330 7 Left 953574322 3:44101005-44101027 CCTGCCTGTGAGGAAAGGAAGGG No data
Right 953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG No data
953574324_953574330 3 Left 953574324 3:44101009-44101031 CCTGTGAGGAAAGGAAGGGCCAC No data
Right 953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953574330 Original CRISPR CCCTGAAGACGCCTGGGGAC AGG Intergenic
No off target data available for this crispr