ID: 953575651

View in Genome Browser
Species Human (GRCh38)
Location 3:44111255-44111277
Sequence CCTGCAAAGCAGGGGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953575651_953575658 -6 Left 953575651 3:44111255-44111277 CCTTACACCCCCTGCTTTGCAGG No data
Right 953575658 3:44111272-44111294 TGCAGGAACTCCTTATGGAATGG No data
953575651_953575661 14 Left 953575651 3:44111255-44111277 CCTTACACCCCCTGCTTTGCAGG No data
Right 953575661 3:44111292-44111314 TGGAAGCACATCCAGGCTGAAGG No data
953575651_953575660 7 Left 953575651 3:44111255-44111277 CCTTACACCCCCTGCTTTGCAGG No data
Right 953575660 3:44111285-44111307 TATGGAATGGAAGCACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953575651 Original CRISPR CCTGCAAAGCAGGGGGTGTA AGG (reversed) Intergenic
No off target data available for this crispr