ID: 953575830

View in Genome Browser
Species Human (GRCh38)
Location 3:44112473-44112495
Sequence CTCTGTGTCTGAGGGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953575830_953575837 -1 Left 953575830 3:44112473-44112495 CCTTTTGCCCCTCAGACACAGAG No data
Right 953575837 3:44112495-44112517 GATGGGATAGCGCCAGGATGTGG No data
953575830_953575840 22 Left 953575830 3:44112473-44112495 CCTTTTGCCCCTCAGACACAGAG No data
Right 953575840 3:44112518-44112540 GTTTGTGTTGTCTAATTTCTTGG No data
953575830_953575838 0 Left 953575830 3:44112473-44112495 CCTTTTGCCCCTCAGACACAGAG No data
Right 953575838 3:44112496-44112518 ATGGGATAGCGCCAGGATGTGGG No data
953575830_953575836 -7 Left 953575830 3:44112473-44112495 CCTTTTGCCCCTCAGACACAGAG No data
Right 953575836 3:44112489-44112511 CACAGAGATGGGATAGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953575830 Original CRISPR CTCTGTGTCTGAGGGGCAAA AGG (reversed) Intergenic
No off target data available for this crispr