ID: 953576198

View in Genome Browser
Species Human (GRCh38)
Location 3:44114831-44114853
Sequence GAACTCTCCCTGGCCAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953576198_953576203 16 Left 953576198 3:44114831-44114853 CCTTTCTTGGCCAGGGAGAGTTC No data
Right 953576203 3:44114870-44114892 TGCATGTCCCAGTGACCTGAGGG No data
953576198_953576204 20 Left 953576198 3:44114831-44114853 CCTTTCTTGGCCAGGGAGAGTTC No data
Right 953576204 3:44114874-44114896 TGTCCCAGTGACCTGAGGGCTGG No data
953576198_953576202 15 Left 953576198 3:44114831-44114853 CCTTTCTTGGCCAGGGAGAGTTC No data
Right 953576202 3:44114869-44114891 GTGCATGTCCCAGTGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953576198 Original CRISPR GAACTCTCCCTGGCCAAGAA AGG (reversed) Intergenic
No off target data available for this crispr