ID: 953576611

View in Genome Browser
Species Human (GRCh38)
Location 3:44117698-44117720
Sequence GCGAGCTCCCTTACATCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953576611 Original CRISPR GCGAGCTCCCTTACATCATC AGG (reversed) Intergenic
907438251 1:54463066-54463088 TCTAGCTCCCTTCCACCATCTGG + Intergenic
907777725 1:57535029-57535051 GCTAGCTCCTTTATATCCTCAGG + Intronic
914257883 1:145975395-145975417 GGCAGCTCCCCTACTTCATCCGG + Exonic
1065445479 10:25794225-25794247 GCTAGCTCCTTTAAATGATCAGG - Intergenic
1067561495 10:47307829-47307851 GCAAGCTCCCCTCCATCAACTGG - Intronic
1075282690 10:121154059-121154081 GCAAGGTCACTTACTTCATCAGG + Intergenic
1075824399 10:125342358-125342380 CCGATCACCTTTACATCATCTGG + Intergenic
1078290486 11:10005905-10005927 GTGAGCTACCGTACATCAGCAGG - Intronic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1084956154 11:72692709-72692731 GCCAGCTGCCTTACACCACCTGG - Intronic
1086570908 11:88283346-88283368 GTGAGCTCCCTTAAATAATCAGG - Intergenic
1132799446 16:1744462-1744484 GCGAGCTCCCTCATGGCATCTGG + Intronic
1158050017 18:53205774-53205796 TCTAACTCCCTTCCATCATCAGG + Intronic
946009711 2:216554900-216554922 GAGTGCTCCCTGACATCATTTGG + Intronic
1174903032 20:54521039-54521061 GCTTGCTCCCTTACATCACCTGG + Intronic
1176004192 20:62850815-62850837 GCCAGCTCCCTGTCATCATTGGG + Intronic
1181069242 22:20322123-20322145 GTGAGCTCCCTTTAATTATCTGG - Intergenic
1182906186 22:33938483-33938505 GAGAGCTAACTTACATCATTGGG + Intergenic
1184670144 22:46007979-46008001 CCGAGCTGCATTACCTCATCGGG + Intergenic
951845680 3:27081735-27081757 CCTTGCTCCCTTTCATCATCTGG + Intergenic
953576611 3:44117698-44117720 GCGAGCTCCCTTACATCATCAGG - Intergenic
954426763 3:50447488-50447510 TAGAGCTGCCTTACATAATCAGG - Intronic
955241396 3:57181711-57181733 TAGACCTCCCATACATCATCTGG - Intergenic
968799249 4:2731490-2731512 GTGAGCGCCCTTAAATTATCAGG - Intronic
968944439 4:3656071-3656093 GTGAGCTCCGTTAAATTATCAGG + Intergenic
982193338 4:152880821-152880843 GTCAGCTCCCTTACTTGATCAGG - Intronic
984981990 4:185291135-185291157 GTGAGCTCCTTTAAATGATCAGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991934043 5:71784246-71784268 GGGAGCCTCCTTACATCATGGGG - Intergenic
994456607 5:100016738-100016760 GCGTGCTGGTTTACATCATCAGG - Intergenic
1003426859 6:6003493-6003515 GCGAGCTCACTTTCAGCAGCAGG - Intronic
1013931907 6:115544960-115544982 GGGAGCTCCCTTACCCCATGTGG - Intergenic
1020135363 7:5585009-5585031 GCCAGCCCCCTTAAATTATCAGG - Intergenic
1023065094 7:36368874-36368896 ACTAGCTCCCTTACTTCCTCAGG + Intronic
1048396826 8:134021933-134021955 TCTAGCTCCCTGACATTATCAGG + Intergenic
1056893895 9:90522969-90522991 GCGAGCCCCTTTAAATGATCAGG - Intergenic
1186514704 X:10158454-10158476 GCGAGCGCCGTGACATCACCAGG - Exonic