ID: 953576982

View in Genome Browser
Species Human (GRCh38)
Location 3:44120758-44120780
Sequence CTGTGTGAGCAGCAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953576982_953576985 -9 Left 953576982 3:44120758-44120780 CCTTCCTGCTGCTGCTCACACAG 0: 1
1: 0
2: 8
3: 76
4: 548
Right 953576985 3:44120772-44120794 CTCACACAGGCCTACTCTTAAGG 0: 1
1: 0
2: 0
3: 26
4: 423
953576982_953576988 19 Left 953576982 3:44120758-44120780 CCTTCCTGCTGCTGCTCACACAG 0: 1
1: 0
2: 8
3: 76
4: 548
Right 953576988 3:44120800-44120822 GCATACTCTGTTCCCTGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953576982 Original CRISPR CTGTGTGAGCAGCAGCAGGA AGG (reversed) Intergenic
900202937 1:1419427-1419449 CTGGGTGACCAGCAACTGGACGG + Exonic
900354105 1:2251627-2251649 CTGTGTGGGCAGCATCTGGGGGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
902195931 1:14798127-14798149 CTGTGTAAGCGGCAGCAACAGGG - Intronic
902382116 1:16057669-16057691 CTGTGTGAGCATTGGCAGTAGGG + Intergenic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903192337 1:21663731-21663753 CTGTGGGGGCAGCAGAGGGAAGG - Intronic
904444704 1:30559632-30559654 CTGAGTGAGATGGAGCAGGATGG + Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
905294680 1:36946754-36946776 GTGTATGAGCAGCACCATGATGG - Intronic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907581586 1:55577197-55577219 CTGGGTGATAAGCGGCAGGATGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910610336 1:89134357-89134379 ATTGGTGAGCAGCAGCAGCAGGG - Intronic
911151642 1:94602067-94602089 CTGTGGCAGATGCAGCAGGAAGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912204369 1:107493936-107493958 GTGTGTGAGGAACAGCAAGAGGG + Intergenic
912777141 1:112512974-112512996 CTATGTGGGCTGCAGCAGAATGG + Intronic
912867049 1:113266987-113267009 GTGTTGGAGGAGCAGCAGGAAGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913376122 1:118154402-118154424 CATTGTGAGCTGCAGCAGGGGGG + Intronic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
915748496 1:158182988-158183010 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915755647 1:158256896-158256918 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915762525 1:158329516-158329538 CGGGGTGAGCAGGAGCAGCAGGG - Exonic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916533051 1:165676719-165676741 CTGTGTGAGAACCAACGGGAAGG + Intronic
916674391 1:167053917-167053939 CTGTGTGCCCAGCACCTGGAGGG - Exonic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917495088 1:175533315-175533337 CTCAGTGTGCAGCAGAAGGAAGG + Intronic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
918515571 1:185359067-185359089 GGGAGTAAGCAGCAGCAGGATGG - Intergenic
919278451 1:195452039-195452061 GTGTTTCAGCAGTAGCAGGAGGG + Intergenic
919718253 1:200803035-200803057 ATCTAAGAGCAGCAGCAGGAAGG - Intronic
920071136 1:203304196-203304218 CGGTGGGAACAGGAGCAGGATGG + Intergenic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
922305608 1:224341264-224341286 CTGCGCGAGCTGCAGCAGGAAGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
924775729 1:247113452-247113474 CTGTGGGACCCACAGCAGGAGGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883587 1:248188727-248188749 CTCTCTGAGCAGAAACAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1062853020 10:759899-759921 CTGTGGTAGTAGCAGCAGGGTGG - Intergenic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063145326 10:3290550-3290572 CTGTGTCAACACCAGCAGGCAGG - Intergenic
1063560215 10:7119111-7119133 CTGCGAGAGCTTCAGCAGGAAGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064102231 10:12473703-12473725 GTGTGAGAGCAGCAGCTGGGCGG - Intronic
1064307702 10:14182831-14182853 CTGAGTGAGAACTAGCAGGAGGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065970681 10:30803829-30803851 CTGAGTTAGAGGCAGCAGGAGGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067033962 10:42899356-42899378 GTGTGTGTGCTGCAGAAGGAAGG - Intergenic
1067254680 10:44625149-44625171 GTGTTTGAGCAGTAGCAGTAAGG - Intergenic
1067448830 10:46368954-46368976 CAGTGAGGGCGGCAGCAGGAAGG - Intergenic
1067588542 10:47491811-47491833 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067635668 10:47999902-47999924 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067753928 10:48989794-48989816 CTGTGTGGCCAACATCAGGAAGG + Intergenic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069828088 10:71266412-71266434 CTGAGTGAGCAGCAGAGGAAGGG - Intronic
1070339573 10:75484754-75484776 CTGTGTGAGACACAGCAAGAAGG + Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070785990 10:79162486-79162508 CTGGGTGAGCAGGAGCATGTCGG + Intronic
1071491375 10:86138843-86138865 CTGTGGGCTGAGCAGCAGGATGG + Exonic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072957008 10:99896108-99896130 CTTTGTAACCAGCAGCTGGAGGG + Intronic
1073175547 10:101554499-101554521 GTGTGGGAGAAGCAGAAGGAAGG - Exonic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075235085 10:120720487-120720509 CTGGGTGAGAAACAGCAGGTGGG + Intergenic
1076177198 10:128377237-128377259 CTGTGTGACCAGCAGCCTGTTGG + Intergenic
1076314868 10:129532949-129532971 GTGTCCGAGCAGCTGCAGGAAGG - Intronic
1076712784 10:132347785-132347807 CTTTGTGTGCCGCAGCAGGCTGG + Intronic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076867170 10:133173648-133173670 CTGTGTAAGCAGCACCCAGATGG + Intronic
1077029976 11:461044-461066 GTCTGAGACCAGCAGCAGGATGG + Intronic
1077178033 11:1199416-1199438 CAGTGTGAGAAGCACCAGGATGG + Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077798404 11:5514949-5514971 CTCTGTGGCCAGCAGCTGGAGGG + Exonic
1077971562 11:7197727-7197749 CTGTTGGAGAAGCAGCTGGAAGG - Intergenic
1078852298 11:15175902-15175924 CCGTTTGAGCAGCAGCTGCAGGG - Exonic
1079108010 11:17586312-17586334 CTCACTGAGCAGCAGCAGGATGG + Intronic
1079339428 11:19599774-19599796 CTGTTTGAGAAACAGCATGAGGG + Intronic
1080304055 11:30817806-30817828 ATGAGTGAGAAGCAGAAGGAAGG + Intergenic
1080883546 11:36345091-36345113 GGGTGAGAGCAGCGGCAGGAAGG + Intronic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1081587753 11:44398856-44398878 CTGTGGGAACTGGAGCAGGATGG + Intergenic
1081823154 11:46020408-46020430 GTCTTTGCGCAGCAGCAGGAGGG + Intronic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083256418 11:61498810-61498832 CGGTGTGAGGAGCGGCAGCAGGG - Intergenic
1083297523 11:61723067-61723089 CTGTGGGGGCACCAGCAGGTTGG + Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084560131 11:69900449-69900471 CTATGTGACCAGCCCCAGGAAGG + Intergenic
1085461867 11:76698930-76698952 CTGGGTGGACAGCAGCAGGCAGG - Intergenic
1086560830 11:88167229-88167251 CTGTGTGAGCCACAGCATAAAGG + Intronic
1086913408 11:92498928-92498950 CTCTCTGAGCAGCACCATGACGG - Intronic
1087615608 11:100483317-100483339 ATTTGTGCACAGCAGCAGGATGG + Intergenic
1088326896 11:108609917-108609939 CTGTGTGGGATGGAGCAGGATGG + Intergenic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088635835 11:111819731-111819753 CTCTGTGAGCAACTGCAGCAAGG + Intronic
1088662237 11:112059322-112059344 ATGTGTCAGCAGCAGTAGGTTGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090418222 11:126555617-126555639 CTGCTTGAGGAGCAGCAGGAAGG + Intronic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1091646088 12:2273517-2273539 CTGGGTTAGGACCAGCAGGACGG + Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1092016466 12:5163087-5163109 CTGTGTGTGCGGCAGCGGGGAGG + Intergenic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1092670212 12:10853735-10853757 CTGTGTCAGCAGCCACAGGGAGG - Intronic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096653182 12:53072278-53072300 GAGTGTCAGAAGCAGCAGGAGGG + Intronic
1096777402 12:53972753-53972775 CTCTGTGAGCAGCACCAGGAGGG - Intergenic
1096915650 12:55029393-55029415 CTTTGTGAGCGGCTGTAGGAGGG + Exonic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101460301 12:104884313-104884335 GTGTGTGAGCCGAAGCAGGGTGG - Intronic
1102095805 12:110240317-110240339 GTGTTTGAGAACCAGCAGGATGG + Intergenic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1103403429 12:120658796-120658818 CTGTGTGAGCCTCTTCAGGACGG + Intronic
1103552798 12:121748519-121748541 CAATCTGAGCACCAGCAGGAAGG - Intronic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1104726412 12:131078204-131078226 CTGGGGGTGCAGCAGCAGGTCGG + Intronic
1105218444 13:18304189-18304211 CTGGGAGAACAGCAGCAGTAAGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108572740 13:51767217-51767239 CTGTGCTGGCAGCACCAGGACGG - Exonic
1108601717 13:52000632-52000654 CTGTGGGAGCAGCAGGGGAAGGG - Intronic
1110143986 13:72167336-72167358 CTGGGAGTGCAGCAGCGGGAGGG + Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111587740 13:90304517-90304539 TTATGTGAGCAGCACCAGCAAGG + Intergenic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1112455112 13:99553252-99553274 CTTTGTGAGCAGGACCCGGAAGG + Intronic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113463927 13:110501007-110501029 CAGTATGAGCTGCAGCAAGAAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113756894 13:112818615-112818637 ATCTGTGAGCACCAGCAGGTCGG - Intronic
1113784511 13:112995469-112995491 CTGTGTGAGCTGCTGCTGGGTGG + Intronic
1113949330 13:114062795-114062817 CTGAGGGAGCAACAGCAGAACGG + Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115736704 14:36339353-36339375 GTGTGAGAGCAAGAGCAGGAAGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117781930 14:59242324-59242346 CAGTGTTAGAAGCAGCAGCAGGG + Intronic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118280117 14:64420643-64420665 CTGAGTGGGAAGCAGCTGGAGGG - Intronic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119905392 14:78297607-78297629 CTTTCTGCCCAGCAGCAGGAAGG + Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1120740726 14:88106138-88106160 CAGTGGGAGCAGCTGCAGGCAGG + Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1120831838 14:89004326-89004348 CTGGGTGAGAAGCAGTGGGAGGG + Intergenic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1122123595 14:99567460-99567482 CTGTGTTCTCACCAGCAGGAGGG + Intronic
1122622207 14:103065800-103065822 CTGTTTGAGCAGCATTGGGAAGG - Intergenic
1122639421 14:103149340-103149362 CTTTGTGAGAACCAACAGGAAGG + Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124125831 15:26937529-26937551 CTCTGTGTGCAGCTGCAGGGAGG - Intronic
1124138099 15:27052558-27052580 GTGTTTTAGAAGCAGCAGGAGGG - Intronic
1124141944 15:27084926-27084948 CTGTGTGAGCACCAGCCCTAGGG + Intronic
1125417337 15:39467352-39467374 CTCTGGGAGCAGGAACAGGAGGG - Intergenic
1126416973 15:48427883-48427905 CTGGGTGAGAAGAAGCAAGAGGG + Intronic
1127059728 15:55169909-55169931 CTGTGAGAAGAGCAGCAGGTAGG - Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1128164847 15:65454976-65454998 CAGTTTGAGTAGCAGTAGGAGGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129923903 15:79344898-79344920 GTGTTTGAGCAGTAGCCGGAAGG + Intronic
1129968594 15:79758085-79758107 CTCTGAGAGCAGCAGCGGAAGGG + Intergenic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1132726882 16:1342762-1342784 ATGGCTGAGCAGCAGCAGGTGGG - Exonic
1132997415 16:2830440-2830462 AAGCGTGAGCAGCAGCAGCATGG - Exonic
1133401263 16:5489133-5489155 CTCTGTGGGCAGCAGAGGGAAGG + Intergenic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1136121125 16:28135291-28135313 CTCTGTGAGCAGGAGCACCAGGG + Exonic
1136227251 16:28867176-28867198 CTGTGTTAGCAGCTGCGGGCAGG + Intronic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1137384600 16:48030005-48030027 CCCTGTGACCAGCAGCTGGAAGG + Intergenic
1137468031 16:48729037-48729059 ATGTTTGAGAAGCAGCAGGGAGG - Intergenic
1137516092 16:49145858-49145880 CTGTGTGAGGAGCATCTGCAAGG - Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138124614 16:54428593-54428615 CTGTCTGCCCAGCAGCTGGAGGG + Intergenic
1138396634 16:56709603-56709625 CTGGGTGATCTGCACCAGGATGG - Intronic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141685125 16:85565790-85565812 AGGTGTGAGAAGAAGCAGGAGGG + Intergenic
1141693817 16:85610971-85610993 CTGTTTGAGCAGGACCACGACGG - Intergenic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141859158 16:86704724-86704746 CTGTGTGAACAGCTCCATGAGGG - Intergenic
1142107855 16:88315870-88315892 CTGTGTGTGACTCAGCAGGAGGG - Intergenic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1142605231 17:1077818-1077840 CTGTGGGAGCAGCAGGCGGCTGG - Intronic
1142695027 17:1628775-1628797 CCGGGTGAGCTGCAGCAGGGAGG - Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143108283 17:4540278-4540300 GTGTGTGTGCAGCAGCGTGAGGG + Intronic
1143386146 17:6531793-6531815 ATCTTTGAGCAACAGCAGGAAGG - Intronic
1143722028 17:8819154-8819176 CTGTGACAGGAGCAGCAGGCAGG + Exonic
1143916940 17:10301282-10301304 GTGTGCAACCAGCAGCAGGAAGG + Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144102387 17:11953214-11953236 CTCTGTGGGCAGCAGCTGCAGGG - Intronic
1144705287 17:17363910-17363932 CAGAGTGAGCACCTGCAGGATGG + Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144796288 17:17893412-17893434 CTTTGTGAGCAGCAGAGGGATGG + Intronic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1146272712 17:31494944-31494966 CAGTGTGAGCAGCCTCTGGAAGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1147378122 17:40035070-40035092 CTATGGGAGCAGCGGCAGGTGGG + Intronic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147783941 17:42964526-42964548 TTGTCTGCGCAGAAGCAGGAGGG + Intronic
1149523432 17:57335847-57335869 ATGTGTGAGGAGTAGCAGGGAGG + Intronic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151479159 17:74360237-74360259 CTCTCTGTGCTGCAGCAGGAAGG + Exonic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151770410 17:76156781-76156803 GTGTGGGAGGAGCAGCAGGCTGG - Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1152268363 17:79309402-79309424 AGGTGTGAGAAGCAGCAGGAGGG - Intronic
1152304153 17:79511527-79511549 GGGTGAGGGCAGCAGCAGGAAGG + Intronic
1152466832 17:80471287-80471309 CTGAGGGACCAGCTGCAGGAGGG - Intronic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153227455 18:2909505-2909527 CTGTCTGAGGATCAGCAGGCAGG - Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155185437 18:23383205-23383227 CTCTGTGAGCAGCAGGTGGCTGG + Intronic
1156137905 18:34067303-34067325 ATGTTTGAGGAGCAGCAGGGAGG + Intronic
1156312441 18:35937210-35937232 TGTTGTCAGCAGCAGCAGGAGGG + Intergenic
1156992572 18:43426866-43426888 GTGTGTTAGCACCAGCAGCACGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157445030 18:47738140-47738162 CAGTGTGGGCAGCAGCTGCATGG - Intergenic
1157657211 18:49402337-49402359 CTCTTAGAGCAGCAGCAAGATGG + Intronic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1161131997 19:2595893-2595915 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161132290 19:2598057-2598079 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1161704839 19:5814824-5814846 CAGTGTGAGGTGCAGCAAGAAGG - Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162098414 19:8324660-8324682 CTGGGTGAGCAGCAGCCGCACGG + Exonic
1162341466 19:10093766-10093788 TGGTGTGAGCAGCAACTGGAGGG - Exonic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162967618 19:14163548-14163570 CCGTGACTGCAGCAGCAGGAGGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163799393 19:19355614-19355636 CTGTGTGAGCAGCCCAAGGAAGG + Intronic
1164630013 19:29755913-29755935 ATGTGTCCTCAGCAGCAGGAGGG - Intergenic
1164746694 19:30621682-30621704 CTGGGTGAGGAGCAGCCGGGTGG + Intronic
1164927858 19:32144235-32144257 CTGTGCGAGCTGCAGAAGGTTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165311034 19:35029803-35029825 CTGTGTTGGGAACAGCAGGAGGG + Intergenic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166841230 19:45698524-45698546 CTGTGGGAGCAGCAGGGGGGTGG - Intronic
1168110054 19:54187164-54187186 CAGCGTCAGCAGCAGCTGGACGG + Exonic
1168548028 19:57269981-57270003 CTATGTGAGAAGCACCAGGGTGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925180045 2:1811673-1811695 CGGTGTAAACAGCAGCAGGCAGG - Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926349841 2:11984644-11984666 CTTTGTCAGCGGCAGCATGAGGG - Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927633497 2:24793987-24794009 ATCTTTGGGCAGCAGCAGGAAGG - Intronic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
931441884 2:62295880-62295902 CAGTGAGAGAACCAGCAGGATGG - Intergenic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
933843540 2:86306821-86306843 CTGTGTGAAAAGCAACATGATGG + Intronic
934084279 2:88497023-88497045 CTCTCTGAGCATCTGCAGGATGG + Intergenic
934713485 2:96530180-96530202 CTGGGCGTGCAGCAGCAGAAAGG + Intergenic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936062759 2:109306420-109306442 CTGCAAGGGCAGCAGCAGGATGG - Intronic
936159895 2:110076995-110077017 CATTGAGAGCAGCAGTAGGAAGG - Intergenic
936518700 2:113198653-113198675 CTGTGCAAGCAGCCACAGGAGGG + Intronic
937970472 2:127545414-127545436 CTGGGTGAGCAGCCGCATGCTGG + Intronic
938020945 2:127905428-127905450 CTGTGTGAGGAACAGCAAGAAGG - Intergenic
938241305 2:129744406-129744428 CTATGTGAGGCGCAGCAAGAAGG - Intergenic
940189869 2:151029252-151029274 CTGTGTAAGCATCAACAGAAAGG - Intronic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942386175 2:175445499-175445521 CTGGGTGTGCAGCATCAGGCTGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
944987010 2:205188673-205188695 CTAGGTGACCAGCAGCAGCAGGG + Intronic
945040275 2:205738315-205738337 TGTTGTGAGCAGCAGCAGGGGGG - Intronic
946434144 2:219640886-219640908 CACCGTGAGCAGCAGCAGGAAGG - Exonic
946905055 2:224407673-224407695 CTGGGTGAGCAGCAGAACCAGGG - Intergenic
947914092 2:233820586-233820608 CTGTGTGTGCTACAGCATGATGG + Intronic
947924713 2:233911250-233911272 CTGTGTGTGCTGCAGCCAGAAGG + Intergenic
948266197 2:236636875-236636897 CTTAGTGAGGAGCAGCCGGAAGG + Intergenic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948902737 2:240964563-240964585 CTGTGGGAGCTGGAGCAGGCAGG + Intronic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1168960018 20:1862542-1862564 TTGTGTGAGAAGCAGGAGCAAGG + Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1169065120 20:2690829-2690851 GTCTGAGAGCAGAAGCAGGAAGG + Intergenic
1170047291 20:12098762-12098784 CATTGTCAGCAGCAGCTGGAAGG + Intergenic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1172274267 20:33671251-33671273 CTCTGTAGGCAGCAGCAGGCTGG + Intronic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1173150507 20:40562898-40562920 CTCTCTGAGCAGCTGCAGGGAGG + Intergenic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1173935585 20:46859449-46859471 CTGAGTGTGCAGCTTCAGGAGGG - Intergenic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174059814 20:47825099-47825121 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174072057 20:47906172-47906194 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1174082810 20:47983064-47983086 CTGGGTGAGGAACAGCAGGGGGG + Intergenic
1174133147 20:48359918-48359940 CTGGGTGAGGAACAGCAGGGAGG - Intergenic
1174147192 20:48460154-48460176 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174151985 20:48492497-48492519 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174163253 20:48566425-48566447 CTCTGTGGACAGCAGCTGGAGGG + Intergenic
1174397512 20:50256961-50256983 TTATGTGAGAAGAAGCAGGAGGG - Intergenic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1174663559 20:52236378-52236400 CTCCGTGATCACCAGCAGGATGG - Intergenic
1174728424 20:52889567-52889589 AGGTCTGAGCAGCAGCAGCATGG + Intergenic
1174978483 20:55362846-55362868 CTGTGTGAGCTGTAGCTGGGAGG - Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175856800 20:62125219-62125241 CTGTGAGAGCAGCAACAGCCTGG - Intronic
1175936387 20:62516044-62516066 CTGTGTGGGCACCAGCAAGGTGG - Intergenic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177730654 21:25024171-25024193 GTGTGAGAGCAGCAGTGGGAGGG - Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1179635021 21:42703327-42703349 GTGAGTGAGCACCAGCAGGAGGG + Intronic
1179658324 21:42859488-42859510 CTGAGTGAGCGGCCGCAGGCGGG + Intronic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1181286478 22:21756057-21756079 CTGTCTGGTCGGCAGCAGGAAGG - Exonic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1184803677 22:46777711-46777733 TTGAGTGAGAAGCAGCAAGAAGG + Intronic
1185111016 22:48900271-48900293 CGGTGTGGGCAGCAGCCGGGTGG - Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
949934081 3:9102915-9102937 ATGTGACAGCAGCAGCAGGCGGG + Intronic
950642622 3:14358417-14358439 CCGTGTGAGCAGCACTAGGAGGG - Intergenic
951436470 3:22670726-22670748 CTGTGTGAGCCTCAGCAGAGAGG + Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953982751 3:47420807-47420829 CTGTGCGAGCAGCCTCTGGATGG - Intronic
954274246 3:49532129-49532151 CTGCGGGAGCAGCAGCTGGTGGG + Exonic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
954369906 3:50164746-50164768 CTGTGGAAGCAGCATCATGAGGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
956932704 3:74063645-74063667 TTGTTTGGGCAGCAGCAGGAGGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961448866 3:126993431-126993453 CTTTGTGGGCAGCTGCTGGATGG + Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961558590 3:127713445-127713467 CTGTGTGGGCCCCAGCAGGCAGG - Intronic
961768301 3:129229210-129229232 CTGGGAGATCAGCAACAGGAAGG - Intergenic
961820177 3:129571874-129571896 GTGGGTGAGCAGCAGAAGGCAGG - Intronic
961917700 3:130394062-130394084 CTGTGGTAGCAGCAGCACTACGG - Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963121219 3:141778459-141778481 CTGTGTGAGCAGCAGCCCATCGG + Exonic
963214800 3:142733095-142733117 CTGTGTTAGCTGTAGCAGGGTGG + Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965847511 3:172981492-172981514 CTTTGTGAGGGACAGCAGGATGG - Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
967036466 3:185651970-185651992 CTTGGTGGGCAGCAGCAGGGAGG + Intronic
967231283 3:187339535-187339557 GTGTGTGGGCGGCAGCAGGGTGG + Intergenic
967655540 3:192043863-192043885 ATGTGGGAGGTGCAGCAGGATGG + Intergenic
968274309 3:197428254-197428276 CTGCGTGTGCATCAGCTGGAAGG - Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968509803 4:990679-990701 ATGTGTAGGAAGCAGCAGGAAGG - Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
971234281 4:24827348-24827370 CTTGGGGAGCAGCAGCAAGAGGG - Intronic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973919312 4:55668662-55668684 CCATGTGAGAAGCAGCTGGAAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981085114 4:140675732-140675754 CATTGTAAGCAGCAGCATGATGG + Intronic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
984836662 4:184028781-184028803 CTGTGTGTGCAGCACCAAGTCGG + Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
987171980 5:15268832-15268854 ATGTTTGACCAGAAGCAGGAGGG + Intergenic
987642208 5:20627528-20627550 ATTTGTGAGCAGCATCAGAAAGG + Intergenic
988737403 5:34036043-34036065 CTGTTACAGTAGCAGCAGGAAGG - Intronic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991436938 5:66605908-66605930 GTGTGTGAGCAGCAGCCTGAGGG + Intronic
992634669 5:78716074-78716096 CTGTCTGAGCAGCACCATGATGG - Intronic
992874748 5:81042928-81042950 CGCTGTGAGGAGGAGCAGGATGG + Exonic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
995926051 5:117375914-117375936 TTAGGTGAGCAACAGCAGGAGGG - Intergenic
996249950 5:121317362-121317384 ATGTGCTAGCAGCAGCAGCAAGG + Intergenic
998279203 5:140788413-140788435 CAGTGTGAGCACCAGCAGGCTGG - Exonic
998282397 5:140823895-140823917 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998284322 5:140843444-140843466 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998287558 5:140877595-140877617 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998392673 5:141797425-141797447 GGGTGTGAGAAGAAGCAGGAGGG - Intergenic
998464468 5:142332328-142332350 GTATGTGAGGAGCAGAAGGAAGG + Intergenic
999266680 5:150271125-150271147 CTGTGTGACTAGCAGCAGTCTGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999730841 5:154475897-154475919 CTTTGGCAGCAGCAGCACGAAGG - Exonic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1001275078 5:170344915-170344937 CTGTGTGACGAGCAACAAGAAGG + Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1003472565 6:6450846-6450868 CTGAGTTATCAGCAGAAGGATGG + Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1005859069 6:29887774-29887796 CCCTGAGAGCAGCAGGAGGAGGG - Intergenic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1006424032 6:33952719-33952741 CTGTGTTCGAGGCAGCAGGAAGG + Intergenic
1006905329 6:37529462-37529484 CTGAGACAGCGGCAGCAGGAAGG - Intergenic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1008538825 6:52528803-52528825 CTAGGTGTGCAGCAGCAGGCAGG + Intronic
1009784562 6:68318048-68318070 GGTTGTGAGGAGCAGCAGGAGGG - Intergenic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011073346 6:83409888-83409910 TTGTGTGGACAGCAGCAGAATGG + Intronic
1011657530 6:89565297-89565319 CCCAGTGAGCAGGAGCAGGATGG + Intronic
1011697119 6:89922490-89922512 CTGGGTGGGCAACAGCAGGTAGG - Intergenic
1012840827 6:104326946-104326968 GTGTGAGAGGAGCAGCAGGGAGG - Intergenic
1013193331 6:107822850-107822872 CTGTTTGAGCAACAGCAGCTGGG - Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015700732 6:136033499-136033521 CTGTGGGAGCAACAGCAGAAGGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016947981 6:149551754-149551776 CTGTGATAGTATCAGCAGGATGG + Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1018262988 6:161989362-161989384 TGGTGGGAACAGCAGCAGGAAGG - Intronic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1018333877 6:162763297-162763319 CTCCTTGAGAAGCAGCAGGAAGG + Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019073938 6:169371608-169371630 CAGAGCGAGCAGCACCAGGAAGG + Intergenic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019962191 7:4470055-4470077 CTCTGTCAGCAGCAGCTGGCTGG + Intergenic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1021121450 7:16800382-16800404 CTGTGGGAGGAACAGCACGAAGG + Intronic
1022479169 7:30731883-30731905 AGATGTGAGCAGCATCAGGAAGG - Intronic
1022500910 7:30881967-30881989 CCCTGCGAGCAGCAGCAGGTGGG + Intronic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024916654 7:54507735-54507757 ATGAGAGAGAAGCAGCAGGAAGG + Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025235089 7:57228901-57228923 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1028916440 7:96264289-96264311 ATGTGTGAGGAACAGCATGATGG - Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1029493515 7:100884900-100884922 CTGTGTGAGCCACAGCAGAGGGG - Intronic
1029580472 7:101433739-101433761 CTGTCAGAGCAGCAACAGGAGGG + Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1031994614 7:128221529-128221551 CTGTGGGGGCTGCTGCAGGAGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1034593072 7:152160391-152160413 AAGTGTGAGGAGCACCAGGAGGG - Intronic
1034709570 7:153178970-153178992 CTTTTTGAGCAGCAGGAGAATGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035357085 7:158282669-158282691 CTGTGTGTGGAGCACCAGGAGGG - Intronic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036511159 8:9401659-9401681 AGGTGAGAGGAGCAGCAGGATGG + Intergenic
1036585821 8:10122328-10122350 CTTTGTGAGGATCAGCAGAAAGG + Intronic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1039085826 8:33778470-33778492 CTGTGTGAGCAGCATCTGCTTGG + Intergenic
1039148288 8:34474742-34474764 CTGTGTGAGGAACAGCAAGGAGG + Intergenic
1040005979 8:42621299-42621321 CAGTGTGAGAAGCTGCAGGTCGG + Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1040772355 8:50992447-50992469 GTGTGTGAGCCGAAGCAGGGTGG - Intergenic
1041010164 8:53533639-53533661 CTGTGTGAGAACCAGTGGGAAGG + Intergenic
1041256924 8:55986957-55986979 CTTTGTGAGGACTAGCAGGAAGG - Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043376150 8:79651972-79651994 CTATGGGAGGAGGAGCAGGAAGG + Intronic
1043768307 8:84164609-84164631 AAGTGTGAGCAGCAGCTGAATGG - Intergenic
1044436539 8:92170925-92170947 CTGTTGGGGCAGCAGCAGGGAGG + Intergenic
1044470811 8:92564596-92564618 GTGTGTGAGCAGGACCATGAAGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044832128 8:96261283-96261305 CAGTGTGAGAAGCCTCAGGAGGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1048208037 8:132431272-132431294 TGATGTGAGTAGCAGCAGGAGGG - Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1048596399 8:135871378-135871400 ATATTTTAGCAGCAGCAGGAAGG + Intergenic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049219799 8:141423999-141424021 GTGTGTGACCAGGATCAGGAAGG + Intronic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049402486 8:142435708-142435730 CTGTGTGAGTTGGAGCAGGCAGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049803933 8:144530458-144530480 CTGGATGAGCACCCGCAGGAAGG + Exonic
1050118946 9:2288476-2288498 GGGTTTGAGAAGCAGCAGGACGG + Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051160287 9:14200008-14200030 CTCTGTTAGCAGCAGCAGTAAGG - Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1054771712 9:69089780-69089802 CTGTGTTAGCAGCGTCTGGATGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056782051 9:89557774-89557796 CTGTGGGAGCTGCAGCAAGAAGG - Intergenic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057910389 9:99015683-99015705 CTGGGTGGGCAGCTGCTGGAGGG + Intronic
1059350970 9:113664587-113664609 CTGTGGGAACTCCAGCAGGAAGG + Intergenic
1061151262 9:128829581-128829603 CCGCGTGAGCCTCAGCAGGATGG - Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061620743 9:131809855-131809877 CTGTGTGCCCACCAGCAGGCTGG - Intergenic
1061811965 9:133167417-133167439 GGGGGTGGGCAGCAGCAGGAGGG + Intergenic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062291566 9:135797584-135797606 CTGCGTGAGGACCATCAGGAGGG - Intergenic
1062397908 9:136359921-136359943 CTGGGTGGGCGGCAGCAGGCTGG - Intronic
1062402102 9:136377270-136377292 CTGGCTGGGCAGCATCAGGATGG + Intronic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1186557057 X:10570942-10570964 CTGTGTGGGCAACAGCAGCAAGG + Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187883292 X:23865650-23865672 CTTTGAGGGCAGCAGCAGGGTGG - Intronic
1188114195 X:26223536-26223558 TGGTGTGAGCACCAGCAGCAGGG - Intergenic
1188438474 X:30189864-30189886 CTGTGCAGGCAGCAGCAGAAGGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189173837 X:38934437-38934459 CTGGGAGAGCAGCAATAGGAAGG - Intergenic
1189884908 X:45532777-45532799 CACTCTGAGCAGAAGCAGGAAGG - Intergenic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1192362126 X:70446692-70446714 CTGTGGGAGAAGCAGCAAAATGG + Intronic
1192571332 X:72208459-72208481 CTCTTTGAGCACCAGAAGGAAGG - Exonic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1195394208 X:104393605-104393627 GTGCTTGAGGAGCAGCAGGAAGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1200081154 X:153577082-153577104 CTGAGTGAACCGCTGCAGGATGG - Intronic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic