ID: 953578017

View in Genome Browser
Species Human (GRCh38)
Location 3:44128735-44128757
Sequence GCTTTCCACAGCAGCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953578014_953578017 -10 Left 953578014 3:44128722-44128744 CCAGCTGCAGCCAGCTTTCCACA No data
Right 953578017 3:44128735-44128757 GCTTTCCACAGCAGCTAAGGAGG No data
953578010_953578017 30 Left 953578010 3:44128682-44128704 CCTAGGCACAGGGTGGTGAAGTG No data
Right 953578017 3:44128735-44128757 GCTTTCCACAGCAGCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953578017 Original CRISPR GCTTTCCACAGCAGCTAAGG AGG Intergenic
No off target data available for this crispr