ID: 953578716

View in Genome Browser
Species Human (GRCh38)
Location 3:44134363-44134385
Sequence TCTCAGAGCAGAGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953578715_953578716 -3 Left 953578715 3:44134343-44134365 CCATGGGATTACTCAACTGTTCT No data
Right 953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG No data
953578714_953578716 -2 Left 953578714 3:44134342-44134364 CCCATGGGATTACTCAACTGTTC No data
Right 953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG No data
953578713_953578716 9 Left 953578713 3:44134331-44134353 CCAAACACTTTCCCATGGGATTA No data
Right 953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953578716 Original CRISPR TCTCAGAGCAGAGCTCCAGC AGG Intergenic
No off target data available for this crispr