ID: 953581435

View in Genome Browser
Species Human (GRCh38)
Location 3:44160722-44160744
Sequence TGCACTTTACAATTCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953581435_953581438 7 Left 953581435 3:44160722-44160744 CCTCTGAGGAATTGTAAAGTGCA No data
Right 953581438 3:44160752-44160774 TCACCCCCAAGGAGGCAAAATGG No data
953581435_953581437 -1 Left 953581435 3:44160722-44160744 CCTCTGAGGAATTGTAAAGTGCA No data
Right 953581437 3:44160744-44160766 ATCTCAGTTCACCCCCAAGGAGG No data
953581435_953581436 -4 Left 953581435 3:44160722-44160744 CCTCTGAGGAATTGTAAAGTGCA No data
Right 953581436 3:44160741-44160763 TGCATCTCAGTTCACCCCCAAGG No data
953581435_953581441 11 Left 953581435 3:44160722-44160744 CCTCTGAGGAATTGTAAAGTGCA No data
Right 953581441 3:44160756-44160778 CCCCAAGGAGGCAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953581435 Original CRISPR TGCACTTTACAATTCCTCAG AGG (reversed) Intergenic