ID: 953581436

View in Genome Browser
Species Human (GRCh38)
Location 3:44160741-44160763
Sequence TGCATCTCAGTTCACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953581434_953581436 4 Left 953581434 3:44160714-44160736 CCACAGCACCTCTGAGGAATTGT No data
Right 953581436 3:44160741-44160763 TGCATCTCAGTTCACCCCCAAGG No data
953581435_953581436 -4 Left 953581435 3:44160722-44160744 CCTCTGAGGAATTGTAAAGTGCA No data
Right 953581436 3:44160741-44160763 TGCATCTCAGTTCACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953581436 Original CRISPR TGCATCTCAGTTCACCCCCA AGG Intergenic