ID: 953586314

View in Genome Browser
Species Human (GRCh38)
Location 3:44204401-44204423
Sequence ATGGAGCCACAGCTGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953586310_953586314 6 Left 953586310 3:44204372-44204394 CCTGTTCCAGGTGGAGACAAGAG No data
Right 953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG No data
953586311_953586314 0 Left 953586311 3:44204378-44204400 CCAGGTGGAGACAAGAGAGATAG No data
Right 953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953586314 Original CRISPR ATGGAGCCACAGCTGGAGAA TGG Intergenic
No off target data available for this crispr