ID: 953586630

View in Genome Browser
Species Human (GRCh38)
Location 3:44207064-44207086
Sequence CTGGCTGTGCAGCTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953586630_953586638 24 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data
953586630_953586639 25 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586639 3:44207112-44207134 CAACTTAACTCCTTCCATTTGGG No data
953586630_953586634 -3 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data
953586630_953586635 -2 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953586630 Original CRISPR CTGGCTGTGCAGCTGTGCGT GGG (reversed) Intergenic
No off target data available for this crispr