ID: 953586634

View in Genome Browser
Species Human (GRCh38)
Location 3:44207084-44207106
Sequence CAGCCTGCAAGGCCAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953586629_953586634 14 Left 953586629 3:44207047-44207069 CCTCTCAGCAGCTGGCTCCCACG No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data
953586630_953586634 -3 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data
953586627_953586634 22 Left 953586627 3:44207039-44207061 CCGTGGCTCCTCTCAGCAGCTGG No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data
953586631_953586634 -4 Left 953586631 3:44207065-44207087 CCACGCACAGCTGCACAGCCAGC No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data
953586626_953586634 28 Left 953586626 3:44207033-44207055 CCGGCTCCGTGGCTCCTCTCAGC No data
Right 953586634 3:44207084-44207106 CAGCCTGCAAGGCCAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953586634 Original CRISPR CAGCCTGCAAGGCCAGCTCT AGG Intergenic
No off target data available for this crispr