ID: 953586635

View in Genome Browser
Species Human (GRCh38)
Location 3:44207085-44207107
Sequence AGCCTGCAAGGCCAGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953586626_953586635 29 Left 953586626 3:44207033-44207055 CCGGCTCCGTGGCTCCTCTCAGC No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data
953586630_953586635 -2 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data
953586627_953586635 23 Left 953586627 3:44207039-44207061 CCGTGGCTCCTCTCAGCAGCTGG No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data
953586629_953586635 15 Left 953586629 3:44207047-44207069 CCTCTCAGCAGCTGGCTCCCACG No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data
953586631_953586635 -3 Left 953586631 3:44207065-44207087 CCACGCACAGCTGCACAGCCAGC No data
Right 953586635 3:44207085-44207107 AGCCTGCAAGGCCAGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953586635 Original CRISPR AGCCTGCAAGGCCAGCTCTA GGG Intergenic
No off target data available for this crispr