ID: 953586638

View in Genome Browser
Species Human (GRCh38)
Location 3:44207111-44207133
Sequence GCAACTTAACTCCTTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953586630_953586638 24 Left 953586630 3:44207064-44207086 CCCACGCACAGCTGCACAGCCAG No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data
953586633_953586638 5 Left 953586633 3:44207083-44207105 CCAGCCTGCAAGGCCAGCTCTAG No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data
953586636_953586638 1 Left 953586636 3:44207087-44207109 CCTGCAAGGCCAGCTCTAGGGTT No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data
953586637_953586638 -8 Left 953586637 3:44207096-44207118 CCAGCTCTAGGGTTAGCAACTTA No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data
953586631_953586638 23 Left 953586631 3:44207065-44207087 CCACGCACAGCTGCACAGCCAGC No data
Right 953586638 3:44207111-44207133 GCAACTTAACTCCTTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953586638 Original CRISPR GCAACTTAACTCCTTCCATT TGG Intergenic
No off target data available for this crispr