ID: 953591709

View in Genome Browser
Species Human (GRCh38)
Location 3:44262923-44262945
Sequence CCTCACATGCAAAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953591709_953591715 -3 Left 953591709 3:44262923-44262945 CCACCCTCATTTTGCATGTGAGG 0: 1
1: 0
2: 5
3: 45
4: 306
Right 953591715 3:44262943-44262965 AGGCAAGGCTCACCCAGGACAGG 0: 1
1: 0
2: 5
3: 24
4: 218
953591709_953591719 15 Left 953591709 3:44262923-44262945 CCACCCTCATTTTGCATGTGAGG 0: 1
1: 0
2: 5
3: 45
4: 306
Right 953591719 3:44262961-44262983 ACAGGTGATGGATGCATTTGAGG 0: 1
1: 0
2: 2
3: 10
4: 190
953591709_953591714 -8 Left 953591709 3:44262923-44262945 CCACCCTCATTTTGCATGTGAGG 0: 1
1: 0
2: 5
3: 45
4: 306
Right 953591714 3:44262938-44262960 ATGTGAGGCAAGGCTCACCCAGG 0: 1
1: 0
2: 2
3: 8
4: 158
953591709_953591720 30 Left 953591709 3:44262923-44262945 CCACCCTCATTTTGCATGTGAGG 0: 1
1: 0
2: 5
3: 45
4: 306
Right 953591720 3:44262976-44262998 ATTTGAGGCTTTTAATGTTAAGG 0: 1
1: 1
2: 0
3: 24
4: 294
953591709_953591716 3 Left 953591709 3:44262923-44262945 CCACCCTCATTTTGCATGTGAGG 0: 1
1: 0
2: 5
3: 45
4: 306
Right 953591716 3:44262949-44262971 GGCTCACCCAGGACAGGTGATGG 0: 1
1: 0
2: 1
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953591709 Original CRISPR CCTCACATGCAAAATGAGGG TGG (reversed) Intronic
903060590 1:20666071-20666093 CCTTAGCTACAAAATGAGGGGGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903805839 1:26005191-26005213 CCGAACCTGCAAACTGAGGGTGG - Intergenic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904807762 1:33143686-33143708 CCTCACCCACAGAATGAGGGAGG - Intergenic
905340590 1:37274833-37274855 CCACACAGGCTAAATGTGGGGGG - Intergenic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906678121 1:47708088-47708110 CCTCAGACGCAAAATGTAGGGGG - Intergenic
906688747 1:47779044-47779066 ACTCCCATGCTAAAGGAGGGAGG - Intronic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907912692 1:58840699-58840721 CCTCACCTGAAGAATGATGGGGG + Intergenic
908095370 1:60732009-60732031 CCTCACCTGCTAGATGGGGGAGG - Intergenic
908181302 1:61609067-61609089 CCTCACATGGAAGAGGAGCGGGG - Intergenic
908897261 1:68914251-68914273 CCTCACTTGCAAAATGAGACTGG - Intergenic
908962229 1:69711948-69711970 CCTAATATGCACAATGAGTGGGG + Intronic
909889789 1:80990453-80990475 CTTCCCATGCACAGTGAGGGAGG - Intergenic
910123911 1:83819610-83819632 CCACAGCTGCAAACTGAGGGAGG - Intergenic
910137141 1:83985403-83985425 CCACACTGGCACAATGAGGGTGG + Intronic
910462465 1:87463114-87463136 CCTCACATCCATAAGGATGGTGG + Intergenic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
910656126 1:89620479-89620501 AGACACATGCAAAATCAGGGAGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
913071429 1:115302532-115302554 GCACACATACAGAATGAGGGTGG + Intronic
913126221 1:115792932-115792954 CCTCACATCCAAGATGAAGATGG - Intergenic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914287074 1:146236881-146236903 CCTCACATTTAAAATGTTGGTGG - Intergenic
914548106 1:148687623-148687645 CCTCACATTTAAAATGTTGGTGG - Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
915038939 1:152951627-152951649 GGTCACATGCAAAAGAAGGGTGG - Intergenic
915601510 1:156925492-156925514 CCTCACATCCATAAAGTGGGTGG - Intronic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
918286147 1:183056657-183056679 CCTCACCTGTATAATGAGCGTGG - Intronic
918616412 1:186549630-186549652 CCTTACAAGCCAAAAGAGGGTGG - Intergenic
920166904 1:204042428-204042450 CCTCACCTGAAAAATAAGAGTGG - Intergenic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920534956 1:206731413-206731435 CCACACAGGCAAAATGAAGCAGG - Intronic
921568312 1:216747880-216747902 CATTATAGGCAAAATGAGGGAGG - Intronic
921777945 1:219124784-219124806 CCTCACATGTAAATGGAGAGAGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923443008 1:234039448-234039470 CCTCCCATGGAAGGTGAGGGAGG + Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068715062 10:60178904-60178926 CTTCAAATGCAAAAGGGGGGTGG + Intronic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1072572312 10:96669488-96669510 CCCCACATGAAAAAACAGGGAGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073152373 10:101320875-101320897 CCTCACCTCCAATATGAGAGTGG - Intergenic
1073799179 10:107022693-107022715 ACCCACAGGCAAAATGAAGGTGG - Intronic
1074979272 10:118606618-118606640 ACTCAGATGCCAAATGAGGGTGG - Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075808819 10:125209551-125209573 CCTCCCAAGAAAAATGAGGCAGG - Intergenic
1077343054 11:2034577-2034599 CCTCACCCACAAAATGAGAGGGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078424058 11:11235024-11235046 CCTCACATGCAGGGTGAGGTTGG - Intergenic
1078493308 11:11789634-11789656 ACTCACATTCATATTGAGGGAGG + Intergenic
1079324058 11:19476540-19476562 CCTCACATGTAAAAAAAGGTGGG + Intronic
1080267890 11:30420677-30420699 CCTCCCAAGCAAATTGAGGTAGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080455147 11:32412004-32412026 CCTGAGATGCAAAGTGAAGGTGG - Intronic
1080575792 11:33597910-33597932 CCTCACTTGCTAAACAAGGGTGG + Intronic
1080746388 11:35111934-35111956 TCTCACAGTCAAAAGGAGGGAGG - Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1082717242 11:56629126-56629148 CCACACATGCTAAATGAGTAAGG - Intergenic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1083360696 11:62105368-62105390 GCTCACATGCTAAACAAGGGTGG - Intergenic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086296957 11:85379820-85379842 CCTCAAATGCTAAATGGTGGTGG + Intronic
1086338306 11:85822104-85822126 CCTCACTTGTAAAATGGGAGTGG - Intergenic
1086407818 11:86514010-86514032 CCCCACATGCAGAGAGAGGGAGG + Intronic
1086516225 11:87616533-87616555 CCACAAATGCAAAAAGAGAGGGG + Intergenic
1087056749 11:93944490-93944512 CCTCACATTTAAAATGTTGGTGG + Intergenic
1087745103 11:101935011-101935033 ACTCACATGCACAATGCTGGAGG - Intronic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1090758886 11:129817854-129817876 CCTCAAATGAAAAATGGGTGAGG + Intronic
1202826040 11_KI270721v1_random:89766-89788 CCTCACCCACAAAATGAGAGGGG - Intergenic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096121759 12:49093174-49093196 TCTCAGATGTAAAATGAGGGTGG + Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1097142735 12:56916343-56916365 TCTGACATGGAACATGAGGGGGG - Intergenic
1097490266 12:60259634-60259656 CCCCACATAAAAAATGAGGGAGG + Intergenic
1100856374 12:98761053-98761075 TCTCACACGTAAAATGAGGATGG - Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1102052798 12:109875289-109875311 CCAAACAGGCAAAAGGAGGGAGG + Intronic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1109291443 13:60480321-60480343 CCTCACAAGCCAAAAGAGAGTGG - Intronic
1109393541 13:61724836-61724858 CCTCACATGTAAAGAGAAGGAGG - Intergenic
1110022174 13:70489603-70489625 CCCCACATGTCAAAGGAGGGAGG + Intergenic
1110210697 13:72968769-72968791 CCTCATATGTGAAATGAGAGTGG + Intronic
1110356681 13:74575454-74575476 CCTCACCTGCAAAACAAGGGTGG + Intergenic
1110852879 13:80264463-80264485 CCCCACATGTCAAAGGAGGGAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118291087 14:64524342-64524364 CCTCACTTGAAAAATTAGTGGGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1121288745 14:92757300-92757322 CATCACCTGGAAGATGAGGGAGG + Intergenic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1123104250 14:105830702-105830724 GCTCCCATGCAAACTGAAGGTGG + Intergenic
1124847917 15:33310045-33310067 CCTGACTTCCAAATTGAGGGTGG + Intergenic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127343719 15:58072199-58072221 CCTCAAATTCACAGTGAGGGTGG + Intronic
1127613718 15:60662260-60662282 GCTAACAGGCAAAATGAGGGTGG + Intronic
1128347355 15:66862901-66862923 CTCCACATGTAAAATGAGGCAGG + Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130132460 15:81155600-81155622 CCTCACCTGTAAAATGACCGGGG - Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1134234895 16:12457737-12457759 CCTCACATACAAGATGGGGCTGG - Intronic
1134267914 16:12707576-12707598 CCTCACATGCTAACTGAGGCAGG + Intronic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134788140 16:16963476-16963498 CCCCACTTACAAAATGGGGGTGG + Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1137413740 16:48252299-48252321 CAACACCTGTAAAATGAGGGAGG + Exonic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1138885105 16:61067195-61067217 CTTCAGATGAAAAATGAGTGTGG + Intergenic
1139400370 16:66676541-66676563 CCTCACCTGTAAAACAAGGGAGG + Intronic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142118560 16:88374366-88374388 CATCACATACAGAATGAGTGAGG + Intergenic
1144504286 17:15817115-15817137 TATCACATGCACAATGGGGGGGG - Intergenic
1145035642 17:19538693-19538715 CCTCACATGTAAAAGAAGGGGGG + Intronic
1145168142 17:20632624-20632646 TATCACATGCACAATGGGGGGGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147200526 17:38798907-38798929 CCTCACAAACAGGATGAGGGGGG + Intronic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1148732654 17:49846915-49846937 CCTCACCTGCAAAACGGAGGAGG - Intronic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1150143775 17:62751291-62751313 CCTCACCTGCAAAACGAGACGGG + Intronic
1155049312 18:22132722-22132744 CCTCAGAAGCAAAAAGAGTGGGG - Intergenic
1156029276 18:32693299-32693321 CCTCACGTGCCAAATGAGTCAGG + Intronic
1156029852 18:32700088-32700110 CCTTAGATGTAAAATGTGGGAGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1158155554 18:54422008-54422030 GCTCCCAAGCAAAAAGAGGGAGG + Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1161029855 19:2052434-2052456 ACCCACATGCACAATAAGGGGGG - Intergenic
1161120688 19:2524194-2524216 GCTCACATGGAAATTGCGGGCGG - Intronic
1161177316 19:2852703-2852725 CCTTACATGCCGATTGAGGGAGG - Exonic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1166663747 19:44664576-44664598 CCTCCCATGGAATATGAGGTGGG - Intronic
1166818912 19:45564373-45564395 CCACACATGCAAAGTGACTGAGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925097447 2:1218631-1218653 CCTCACTTGCAAAATGATTGTGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
927150093 2:20190527-20190549 CCTCATTTGCGAAAAGAGGGTGG + Intergenic
927483901 2:23475733-23475755 CCTCTCATGCTAAATGTGTGGGG + Intronic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
932096072 2:68849933-68849955 CATCACCAGAAAAATGAGGGTGG - Intergenic
932569793 2:72932589-72932611 CCTCTCATGCATAATCTGGGAGG - Intronic
933014020 2:77101381-77101403 GCGTACATACAAAATGAGGGGGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935641704 2:105297075-105297097 GCTCACAGGTAAAATGAGGATGG - Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941417504 2:165240232-165240254 CCTCACATCCATACTGGGGGAGG - Intronic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
943753361 2:191533074-191533096 CCTCACACCCAGAATGAAGGCGG + Intergenic
944477347 2:200120423-200120445 CCTCACCTTTGAAATGAGGGAGG - Intergenic
947429449 2:230013242-230013264 CCTCACATGGAAAATGAGATGGG - Intergenic
948109787 2:235445280-235445302 GCTCACAAGAAAAATGGGGGTGG - Intergenic
948809864 2:240468982-240469004 CCTCCCCTGGGAAATGAGGGTGG + Intergenic
1170039750 20:12027511-12027533 ACTCACCTGTAAAATGAAGGAGG - Intergenic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170601371 20:17843858-17843880 GTTCACAAGCAAAATGAGGGAGG + Intergenic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1171794252 20:29554200-29554222 CCTCACCAGTAAAAAGAGGGAGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1174187192 20:48714973-48714995 TCTAACATGCGAAAGGAGGGAGG + Intronic
1174955161 20:55089716-55089738 CCTCACATGCCCAGAGAGGGGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176990036 21:15484817-15484839 TCTCACAAGCAAAGTGAGGAGGG - Intergenic
1178125076 21:29507361-29507383 CCTCAGATGCAACATGAAAGGGG + Intronic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1181598659 22:23935834-23935856 ACTTACATTCAAAATGAGTGGGG - Intergenic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1181967633 22:26668071-26668093 CCTCAGATGCAGAATTAGGCTGG + Intergenic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182821477 22:33220526-33220548 CTTCAAATGAAAAAGGAGGGAGG - Intronic
1182866617 22:33609939-33609961 CATCACATGCAAGAGGAGAGTGG - Intronic
1183059672 22:35328441-35328463 CCTGACCTGGAAAATGGGGGTGG - Intronic
1183384947 22:37509335-37509357 GCTCACACTCAAAATCAGGGGGG + Intronic
1183943898 22:41313066-41313088 TCTCACATAAAAAATGAGGTGGG + Intronic
1184128584 22:42503818-42503840 CCGCACGTGTAAAATGAGGTTGG + Intergenic
1184137378 22:42557133-42557155 CCGCACGTGTAAAATGAGGTTGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
949495584 3:4628676-4628698 ACTCACATGCCAGAGGAGGGAGG - Intronic
949943104 3:9169930-9169952 CCTCTCCTGTAAAATGAAGGGGG + Intronic
950127248 3:10517407-10517429 CCCCATATTCAAAATGAGAGGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950426444 3:12927137-12927159 CCTCACCTGGAAGCTGAGGGAGG - Intronic
950463224 3:13138085-13138107 CTCCATATGCAAAATGAGAGGGG + Intergenic
950706456 3:14785519-14785541 CCTCACCTGTACAATCAGGGAGG - Intergenic
951373898 3:21889321-21889343 CCTCAGATGCAAGATGGGGGAGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952171372 3:30810832-30810854 CCTTCCACGCAAAATGAGAGGGG + Intronic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
953029682 3:39170607-39170629 GCTCACATGCAGAATGATAGAGG + Intergenic
953408194 3:42670684-42670706 ACTTACATGCAAATTAAGGGGGG + Intergenic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955926306 3:64008657-64008679 CCTCACATGCACAATATTGGGGG + Intergenic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
958863590 3:99473217-99473239 CCACACAGGAATAATGAGGGTGG + Intergenic
959860348 3:111208666-111208688 GCTCACATCCAGACTGAGGGAGG - Intronic
959924948 3:111910551-111910573 CCTCAAATGCAAACTGGGGTTGG - Intronic
962477434 3:135767746-135767768 CCTCTGGTGCAAAATGAAGGTGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
968954414 4:3710930-3710952 CCACACCTGCAAAATCAGGGTGG - Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
971821116 4:31556433-31556455 CATCACATGCAAAATGGAAGAGG - Intergenic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
976985725 4:91294531-91294553 CCTGAAATGCAAAATCAGGATGG + Intronic
977490190 4:97700985-97701007 CCTCACAGGCCAAATGGGAGAGG + Intronic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
983539914 4:168898267-168898289 CCTATCATCCAAAAAGAGGGGGG - Intronic
984596574 4:181675771-181675793 TTTTGCATGCAAAATGAGGGTGG + Intergenic
986010814 5:3713438-3713460 CCTCACATCTAAAATGTGGGTGG - Intergenic
987259244 5:16187251-16187273 ACTCAGGTGGAAAATGAGGGAGG - Intergenic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
989362870 5:40623501-40623523 CCTCATAGGCAAAATCAGTGAGG + Intergenic
989496830 5:42118590-42118612 CCTCACTTGCAAAATAAAGAAGG - Intergenic
989510923 5:42286859-42286881 CTCCACATGCCAAGTGAGGGAGG + Intergenic
990309318 5:54522736-54522758 ACCCAGCTGCAAAATGAGGGTGG + Intronic
992071505 5:73153260-73153282 CATCACATAAAAAATAAGGGTGG - Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995739619 5:115341744-115341766 TCTCACATACAAAATAAGAGGGG - Intergenic
996157216 5:120116241-120116263 TCTCACAAGAAAAATGAAGGAGG - Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999599313 5:153243520-153243542 CCTCACATTCAATATGAAGATGG - Intergenic
1000379128 5:160613183-160613205 CTTCACCTGGAAAATCAGGGTGG + Intronic
1000778238 5:165445555-165445577 TCTCACATGGAAAATGAAGATGG - Intergenic
1001113731 5:168921328-168921350 CCTCACGTACAAAATGAAGAGGG + Intronic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003767661 6:9259299-9259321 ACTCACATGCTAAGTGAGAGAGG + Intergenic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1004109940 6:12707896-12707918 CCTCACATGAAAATCAAGGGAGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004676378 6:17846766-17846788 ACTCACATCCAAAATTAAGGGGG + Intronic
1005367352 6:25092275-25092297 CCTCACCTGCAAATTTATGGTGG - Intergenic
1006561692 6:34918346-34918368 TCTCACTTCCAAAATGGGGGTGG + Intronic
1006575210 6:35040168-35040190 CCTCAGTTGCAAAATCAGTGGGG + Intronic
1006946110 6:37785444-37785466 CCTCACCTCCAAAATGAAGCAGG - Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008037680 6:46763252-46763274 CCTCACATATAAATTTAGGGGGG - Intergenic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1009266523 6:61562253-61562275 CCTGAGAGGCAAAATCAGGGAGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1014611069 6:123546926-123546948 CCTAACATGCAAAATAATGATGG + Intronic
1017181364 6:151555854-151555876 CCTCACAGGCAATAAGAAGGAGG - Intronic
1018668377 6:166160462-166160484 CCTCACATATAAAAGGAAGGTGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1026277719 7:68894768-68894790 CCTCACATGGAGGAAGAGGGAGG - Intergenic
1026543190 7:71298792-71298814 CCTCACATCCAAAATGAATTTGG - Intronic
1028155927 7:87429308-87429330 CCTCACTTGCTAAATGAGCAGGG - Intronic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1031436903 7:121743195-121743217 GATCACATGCAAAGGGAGGGTGG + Intergenic
1031948171 7:127863046-127863068 CCTTGTTTGCAAAATGAGGGAGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035976405 8:4316665-4316687 ACTCAAATGCAAACTAAGGGGGG + Intronic
1037041603 8:14243063-14243085 CCTCAGATTCCAAATGAGGAGGG + Intronic
1037925305 8:22839472-22839494 CTCCACATGCAAAATGGGAGAGG + Intronic
1038309123 8:26431914-26431936 CCACACATGCAAATTAAGAGTGG - Intronic
1040288889 8:46114264-46114286 CCTCACAAGCAAAAACAGTGTGG - Intergenic
1040721624 8:50330897-50330919 CCTCACATGTCAAGGGAGGGAGG - Intronic
1041263835 8:56045028-56045050 CCTCAGATGCTAAATTAGGAGGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1043093869 8:75939790-75939812 TCTTACATGCAAAATGATGGAGG + Intergenic
1044119318 8:88375251-88375273 CCAAACATGCAAAGAGAGGGTGG + Intergenic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048060791 8:130917492-130917514 ACTCACATTCAAAAGCAGGGTGG + Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1052587610 9:30449395-30449417 TCTTTCATGAAAAATGAGGGAGG - Intergenic
1052896559 9:33752378-33752400 CCTCAAATGTAAAATGGGTGAGG + Intronic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1059246461 9:112853775-112853797 GCTTCCATGCAAAATGTGGGTGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1189183500 X:39028973-39028995 CCTCATAGGCCAAATGAGAGTGG - Intergenic
1189516291 X:41716385-41716407 GCTCACATTCAACATGAGTGGGG + Intronic
1189681641 X:43522543-43522565 GCTTACATTCAAAATGAGGTTGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190554018 X:51615605-51615627 CCTCACAATGAAGATGAGGGTGG + Intergenic
1190635197 X:52426197-52426219 ACTCCCCTGCAAACTGAGGGAGG - Intergenic
1191749740 X:64528909-64528931 CCTCAAATGCATAGTGAGGTAGG - Intergenic
1192094897 X:68200172-68200194 CCTCACTGGTAAAATGGGGGGGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1193140198 X:78018988-78019010 CCCCACATGCCAAGGGAGGGAGG - Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199165430 X:144667913-144667935 ACTCAAATGCAAAATTAAGGTGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic