ID: 953591723

View in Genome Browser
Species Human (GRCh38)
Location 3:44263022-44263044
Sequence TTGGAGAAGCATCATCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953591723 Original CRISPR TTGGAGAAGCATCATCATGT AGG Intronic
901161114 1:7177286-7177308 TGGGAGAGGCTTCAGCATGTGGG - Intronic
902671173 1:17974982-17975004 TTGAAGACGCTTCACCATGTAGG + Intergenic
910447375 1:87312444-87312466 TTGCAGAAACATCATCCTGAAGG + Intergenic
912178843 1:107193293-107193315 TTGGAGAAACAGCAGCAAGTAGG - Intronic
912326471 1:108768085-108768107 TTGGAGAAGCATCTTGTAGTCGG + Intronic
912633139 1:111266778-111266800 TTGTAGAGGTATCATCTTGTTGG + Intergenic
912823572 1:112886107-112886129 AGGGAGAAGGATCATCATTTTGG - Intergenic
913011253 1:114686007-114686029 TTGCAGAATCAGCATCATATTGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
920078272 1:203352867-203352889 TTTGAGAACCATTATAATGTGGG + Intergenic
921495400 1:215834565-215834587 GTGAAGCAGCATCATGATGTCGG - Intronic
922188197 1:223294717-223294739 TTGTAAAAGCATCATCAGTTTGG - Intronic
1063021218 10:2129470-2129492 ATGGAAAAGCATCATTATTTGGG + Intergenic
1065246981 10:23768371-23768393 TTTGAGAACCATCAGAATGTTGG + Intronic
1072838522 10:98743508-98743530 TTTTAGAAGGATCATCTTGTAGG + Intronic
1074835523 10:117289052-117289074 ATGCATAAGCATCATCATTTGGG + Intronic
1075719163 10:124574925-124574947 CTGGAGAAGCATCATCTGGCTGG - Intronic
1080434221 11:32224828-32224850 TTGGAGAAGGATCTACAAGTAGG - Intergenic
1080674351 11:34411054-34411076 TTACAGAAGCCTCATTATGTAGG - Intergenic
1081414706 11:42800658-42800680 TTGAAAAATCAACATCATGTTGG - Intergenic
1081446958 11:43139967-43139989 TTGGGGAATCATCAGCATGGGGG - Intergenic
1081771079 11:45650933-45650955 TTGGAGAAGCAGCCCCATGAAGG - Exonic
1083012510 11:59416754-59416776 TGGGAGAATCATCAAGATGTGGG - Intergenic
1086020433 11:82222475-82222497 TTGGAAAAGCTTCATGATATTGG - Intergenic
1086937309 11:92759061-92759083 TTGGAGAATTAGCAGCATGTAGG + Intronic
1087349649 11:97015393-97015415 TTGGTGGAGCTTCATTATGTAGG + Intergenic
1088179620 11:107093912-107093934 TTGCAAAAACATCATCATCTTGG + Intergenic
1088899741 11:114106337-114106359 TTTAAGAAGCATCATTATGATGG + Intronic
1088997947 11:115019752-115019774 TTAGGGAAGCTTCCTCATGTAGG + Intergenic
1089342231 11:117765856-117765878 TTAGAGAAGCAAAATCCTGTGGG - Intronic
1089442524 11:118529303-118529325 TTCGAGGAGCAGTATCATGTGGG - Intronic
1093497616 12:19775893-19775915 TGGGAGAGGGATCATCATGGTGG - Intergenic
1094787665 12:33869011-33869033 TTGGAGTAGGATGATGATGTTGG + Intergenic
1096273589 12:50186563-50186585 TTGGATAAGCATCTTTATGAGGG - Intronic
1096424868 12:51492484-51492506 TTGGAGAAGCAGCAACGTTTAGG - Intronic
1097014625 12:55976616-55976638 TAGGAGAACCATCATCATCATGG - Intronic
1097781640 12:63713477-63713499 TTGGATAAGCATCCTGATGTGGG - Intergenic
1098500610 12:71187584-71187606 GTGGGGAAGGATCATCAGGTGGG - Intronic
1100023124 12:90095903-90095925 TTGGAAATGGATCATCATGGAGG + Intergenic
1103151892 12:118648094-118648116 TGGGAGAAGTATCAGGATGTGGG + Intergenic
1108152958 13:47555577-47555599 TTGGAGAAGCAGCATGGTGCAGG - Intergenic
1112612875 13:100973256-100973278 TTATAGAAGCTTCATTATGTAGG + Intergenic
1113064942 13:106363410-106363432 TTTGAGAAGCAGCATTATTTGGG - Intergenic
1114705432 14:24721786-24721808 TTGGAGAAGCCTCGTGAAGTGGG + Intergenic
1118427147 14:65678316-65678338 GTGGAGAATGATCCTCATGTGGG - Intronic
1118707158 14:68491074-68491096 TTGGAGAGGCATCCAAATGTAGG - Intronic
1125692727 15:41609705-41609727 ATGAAGAAGCATCATCAAATCGG - Intergenic
1126347170 15:47708435-47708457 TTGTAAAAGCTTCATGATGTGGG - Intronic
1126375324 15:47991570-47991592 TTGGAGCAGCTGCCTCATGTTGG - Intergenic
1128527271 15:68421175-68421197 TTGGAGGAGCTTCCTCAGGTGGG + Intronic
1128527522 15:68422547-68422569 TTGGAGGAGCTTCCTCAGGTGGG - Intronic
1129331751 15:74831453-74831475 ATGGAGCAGCCTCATTATGTGGG + Exonic
1130035560 15:80357856-80357878 TTAGAGAAGCTTCATCACATAGG - Intronic
1130633273 15:85591488-85591510 TTGGAGAAACATCATCTTAGTGG - Intronic
1132874533 16:2130462-2130484 TTGGAGAATCATCTGCGTGTTGG + Intronic
1134883653 16:17770591-17770613 TTGGTGGAACAACATCATGTAGG - Intergenic
1135241616 16:20811952-20811974 TTGGACCATCATCATCATCTTGG - Intronic
1135340823 16:21646570-21646592 TTGGTTAAACATCACCATGTAGG + Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1137004374 16:35259281-35259303 ATGCAGAAGCATCATCTTTTTGG - Intergenic
1138177423 16:54913358-54913380 TGGGACAAGCATCTTCAAGTTGG + Intergenic
1141968800 16:87465739-87465761 ATGCAGCAGCATTATCATGTGGG - Intronic
1148345470 17:46900613-46900635 TTGGAGAAGGAGCAGCATTTAGG + Intergenic
1149385024 17:56134324-56134346 TTATGGAGGCATCATCATGTAGG + Intronic
1149693118 17:58595053-58595075 ATGGTGAAGCATCATGATATAGG - Intronic
1150456528 17:65310900-65310922 TAGGAGAAGCAAAATCCTGTTGG + Intergenic
1153400238 18:4677160-4677182 TTGGAGAAGGATCAGCTTTTTGG + Intergenic
1156511068 18:37637272-37637294 TTAGAAAAGCATCATAGTGTTGG - Intergenic
1158038075 18:53058879-53058901 TTGGAGAAGTAGCCTCATGAAGG + Intronic
1158307488 18:56122501-56122523 TTGGTGAGCCATCATCATCTAGG + Intergenic
1158653165 18:59305742-59305764 TTTGAGAATCATCAACATGTAGG + Intronic
1159108222 18:64027339-64027361 TTGGGGAGGCATCATCCTGAGGG + Intergenic
1160060941 18:75528094-75528116 TGGGAGCAGCATCATCCTGTTGG + Intergenic
1164515604 19:28932738-28932760 TTGAAGAATCATCCTCCTGTTGG - Intergenic
1167821867 19:51935737-51935759 TTGGTGTTGCAGCATCATGTTGG + Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926907067 2:17816010-17816032 TTGGAGAAGCAGCATGGTCTAGG - Intergenic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
929680924 2:43992887-43992909 TGGGAGAAACATCATCAGATAGG + Intronic
929802941 2:45119841-45119863 TTGAAGAACCATCATCCTTTGGG + Intergenic
929850001 2:45578016-45578038 TTCCAGCAGCATCACCATGTAGG + Intronic
931162710 2:59711314-59711336 TTCTGGAATCATCATCATGTAGG - Intergenic
931640773 2:64379278-64379300 CTTGAGAAGCATCATCACTTTGG - Intergenic
936558265 2:113514604-113514626 TTGGGGAATCATCAGCATGGGGG + Intergenic
936722325 2:115267694-115267716 TAGGAGAAGAATAAGCATGTGGG - Intronic
937773350 2:125747373-125747395 TTGGAGATGCTTCAAAATGTGGG - Intergenic
938390347 2:130899879-130899901 TTGCAGATGTATGATCATGTAGG + Intronic
940034044 2:149294672-149294694 TTTGAGAAACATCATCAGATTGG + Intergenic
941010175 2:160290666-160290688 TTGGAGATGCATGTTCCTGTTGG - Intronic
942482173 2:176400885-176400907 TTGGAGATGCATCTACACGTGGG + Intergenic
944044660 2:195395526-195395548 TTAGAGTTGCATCACCATGTTGG + Intergenic
944446391 2:199794955-199794977 TTGAAGAGGCAACAACATGTAGG + Intronic
945321683 2:208431692-208431714 TGGGAGAAGTATCATCTTTTGGG + Intronic
947281455 2:228460286-228460308 TTGCTGAAGCATGAGCATGTAGG - Intergenic
1168946307 20:1761607-1761629 TTACAGAAGCTTCATTATGTAGG + Intergenic
1169722872 20:8698319-8698341 TTGGTGAAGCTACATCATTTAGG - Intronic
1177847478 21:26307196-26307218 TTGCAAAAAGATCATCATGTAGG + Intergenic
1184003883 22:41694847-41694869 TGGGAGAAGCATGATCAAGGTGG + Exonic
1184636565 22:45836845-45836867 TTTGTGAAGCATCTTCATCTAGG + Intronic
951243886 3:20317698-20317720 TTGCAGAAGCATCCACCTGTAGG + Intergenic
951488156 3:23237487-23237509 TTGTAGAAGCCTCATCAGCTGGG + Intronic
952532031 3:34272674-34272696 TTGCAGAAACATCATAATATTGG - Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
954158173 3:48699570-48699592 TGGGAAAATCATCATCATTTTGG + Intronic
954558999 3:51539662-51539684 TTGGAGAATCAGCTTTATGTGGG + Intergenic
956283640 3:67585616-67585638 TGGGAGAAGCATCAGCATGATGG - Intronic
957176070 3:76811578-76811600 TTGGTGAATCATCACCCTGTAGG + Intronic
957799507 3:85057861-85057883 TTGCAGAAGCCTTAACATGTGGG + Intronic
959975793 3:112457904-112457926 CTGGAGAAGCATCGATATGTTGG - Intergenic
961831674 3:129626371-129626393 TTGGAGATGCATCCTTGTGTCGG - Intergenic
962678481 3:137774055-137774077 CTGGAGAAGATTCATCCTGTGGG - Intergenic
962698556 3:137974690-137974712 TTAGAGAAACAAAATCATGTAGG - Intergenic
962764588 3:138549602-138549624 ATAGAGAAGGACCATCATGTTGG - Intronic
965300957 3:167003709-167003731 TTGTGGAAGCTTCATTATGTAGG - Intergenic
966239488 3:177740536-177740558 TTGGGAAAGCATCAACATTTAGG + Intergenic
967216156 3:187212351-187212373 TTGGAGAGCCATCAGCATTTAGG + Intergenic
973882820 4:55291002-55291024 TTGGGGAAGCATCACTATGAAGG - Intergenic
975065744 4:70061522-70061544 TTTGAGAAGACTCATCATGAAGG - Intergenic
976431798 4:84970672-84970694 GTGGAGAAGGATCATCATAAAGG - Intergenic
979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG + Intergenic
980556785 4:134417903-134417925 TTTGTGGAGAATCATCATGTTGG - Intergenic
981104179 4:140862089-140862111 TTGGAGAAGCAGGGTAATGTGGG - Exonic
984581904 4:181519567-181519589 TTTGAGAGGCATAATTATGTTGG + Intergenic
986486738 5:8245560-8245582 TTTGAGAAGCATCATCACGTGGG + Intergenic
989023827 5:37042682-37042704 AAGGAGAAGCACCAGCATGTCGG - Intronic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
990349833 5:54904709-54904731 TTGGAGGAGTTTCATCATGAAGG - Intergenic
990558089 5:56955108-56955130 TTGGAGAAGCATACAAATGTAGG + Intronic
991025093 5:62020479-62020501 TTGAAGAAGCATCATCTTGCTGG + Intergenic
991399257 5:66236308-66236330 TGATAGAAGCTTCATCATGTGGG - Intergenic
991694537 5:69258092-69258114 TTGAAGAGTCATCAACATGTAGG - Exonic
993097754 5:83499932-83499954 TTAGATAAACATCATCAAGTAGG + Intronic
993917060 5:93756265-93756287 TTAGGGAAGGATCATCATATGGG - Intronic
994080307 5:95701334-95701356 TTGGAGAAGCAGATTCCTGTGGG - Intergenic
996750749 5:126886355-126886377 TTGGAGAAGCAGCACCTTGCTGG + Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
999140629 5:149358956-149358978 TTGGAGATGCATCAAAATGTAGG - Intronic
1001769693 5:174284194-174284216 TTGGAGAAGCTTCATAAAGAAGG + Intergenic
1004272611 6:14209417-14209439 TTGGAGAAGCATAACCATTAAGG + Intergenic
1004931695 6:20468556-20468578 TTTGGGAAGCTTCATTATGTTGG + Intronic
1007838202 6:44693813-44693835 TTGGAGCAGCAACAGAATGTCGG + Intergenic
1011302073 6:85886351-85886373 TTTGAGAGTCATTATCATGTAGG + Intergenic
1011871180 6:91895290-91895312 TTTTAGGAGCATCATCCTGTGGG - Intergenic
1012351713 6:98259632-98259654 TTGGAGAAGAATCTTCAGATAGG + Intergenic
1016740597 6:147524726-147524748 TGGGAGAAGCTTCATGCTGTTGG + Intronic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1022557109 7:31309316-31309338 TTTGAGAAGTATCCTCATTTGGG - Intergenic
1022940240 7:35229571-35229593 TTGGATAAGCATCCTGATGTGGG - Intronic
1024180366 7:46886935-46886957 TTGGAGCAGTATGATCATGATGG - Intergenic
1024445252 7:49470363-49470385 TTATGGAAGCTTCATCATGTAGG - Intergenic
1026083390 7:67242012-67242034 TTACGGAAGCTTCATCATGTAGG + Intergenic
1026693656 7:72572015-72572037 TTACGGAAGCTTCATCATGTAGG - Intronic
1027614381 7:80403137-80403159 TTGGATAAGCATCCTTATGTGGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027878096 7:83797660-83797682 TTATAGAAGTTTCATCATGTAGG + Intergenic
1031520415 7:122757973-122757995 TAGGAAAAGCATCATTATCTTGG - Intronic
1033045788 7:137961349-137961371 TTGGGGAAGGAACATCATGGGGG + Intronic
1034761156 7:153673082-153673104 CTTGAAAAGCATCAGCATGTAGG - Intergenic
1035756640 8:2037724-2037746 CTGCAGAAGCATGATCAGGTGGG + Intergenic
1036246378 8:7120599-7120621 TTAGAGACGTTTCATCATGTTGG - Intergenic
1036504110 8:9339640-9339662 ATGGAGAGGCAACATCAAGTTGG + Intergenic
1037933072 8:22895317-22895339 CTGGAGAGGCATAATAATGTTGG + Intronic
1038477537 8:27878568-27878590 TTGGAGAGTCTTCATCATTTTGG - Intronic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1040568322 8:48586790-48586812 TTGGAGCAGCACCACCATGGCGG - Intergenic
1042502317 8:69523073-69523095 GAGGAGAAGCATGATCATCTGGG + Intronic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1044343294 8:91071820-91071842 TTGGTGAAGCTTCATCTTTTGGG - Intronic
1044590036 8:93905397-93905419 CTGCAAAAGCAGCATCATGTAGG + Intronic
1045250229 8:100476706-100476728 TTGGAGAAGGAGCATCTGGTTGG + Intergenic
1045406650 8:101873359-101873381 TTTGGGAAGCATCACCATGAAGG - Intronic
1045524953 8:102933598-102933620 TTGGAGAAGAATCACCAGGATGG - Intronic
1045677924 8:104628682-104628704 ATAGAGAAGCATCACCGTGTAGG - Intronic
1045684061 8:104692922-104692944 TTGATGAAACATCATCATTTTGG + Intronic
1048169123 8:132088427-132088449 TTGGAGAAGTTACATCAGGTAGG + Intronic
1048215864 8:132494059-132494081 CTGGAGAGGCTACATCATGTAGG - Intergenic
1048237164 8:132701949-132701971 TTGGATAAACATCAAGATGTTGG + Intronic
1049163721 8:141113732-141113754 TTGGAGTGTCAGCATCATGTAGG + Intergenic
1049894597 9:101662-101684 TTGGGGAATCATCAGCATGGGGG - Intergenic
1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG + Intronic
1052357079 9:27516147-27516169 TGGCAGAAGCATTATCATGATGG + Intronic
1053735804 9:41101652-41101674 TTGGGGAATCATCAGCATGAGGG - Intergenic
1054692572 9:68329746-68329768 TTGGGGAATCATCAGCATGGGGG + Intronic
1056963635 9:91148196-91148218 TTGGAGAATCATCTTCAAATGGG + Intergenic
1057880699 9:98790757-98790779 ATGCAGATGCATCATCATGAAGG + Intronic
1058702927 9:107615498-107615520 TGGGAGAACTCTCATCATGTGGG - Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186672121 X:11778387-11778409 CAGGAGAAGCATCATCCTGTAGG - Intergenic
1187747945 X:22430164-22430186 TTCCAGAAGCAGTATCATGTAGG - Intergenic
1190248968 X:48708028-48708050 TTGGGGAACCAGCTTCATGTCGG - Exonic
1191079788 X:56497319-56497341 TTGTAGAAGAATCATAATGCAGG - Intergenic
1191741195 X:64436823-64436845 ATGGACAAGCATCCTCATCTTGG + Intergenic
1193484567 X:82070928-82070950 TTTGGGAACCATCAGCATGTGGG - Intergenic
1194532833 X:95072095-95072117 GTAGAGAAACATCATCAGGTGGG - Intergenic
1198914102 X:141647866-141647888 CTTGAGAAGCATGATCATTTTGG + Intronic
1199720289 X:150538615-150538637 TTTGAGAAGCCCCAGCATGTTGG + Intergenic
1200274017 X:154714896-154714918 TTGGAAAAGCAGCATTAAGTAGG - Intronic