ID: 953593793

View in Genome Browser
Species Human (GRCh38)
Location 3:44287912-44287934
Sequence GTGAATAAAAGGCAGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953593793 Original CRISPR GTGAATAAAAGGCAGCTCAA GGG (reversed) Intronic
903426246 1:23256541-23256563 GTGAATTAGTGGCAGCTCCAGGG + Intergenic
906121324 1:43393637-43393659 GTTAACAAAAGACAGCACAAGGG + Intronic
907299079 1:53474933-53474955 GTTAATAAAATGTAGCACAAAGG - Intergenic
909382405 1:75014060-75014082 GTGAGTAAAAGGCAGCGAAGTGG + Intergenic
909770958 1:79420579-79420601 TTGAACAAAAGGCAGCTGTATGG + Intergenic
911041105 1:93591794-93591816 GTGAATAACTGCCAGCTCAATGG + Intronic
911138346 1:94467660-94467682 GTGAATCCTAGGCAGGTCAAAGG - Intronic
913378804 1:118185789-118185811 ATCAATAAAAGGCAGTTTAAAGG - Intergenic
913712353 1:121497907-121497929 GTGACTAAAAGGCAACTCAGAGG + Intergenic
916128264 1:161590156-161590178 GTGAAGAAATGGAAACTCAAGGG - Intronic
916138184 1:161671987-161672009 GTGAAGAAATGGAAACTCAAGGG - Intronic
916297865 1:163239639-163239661 CAGAATAAAAGCCAGCTTAAAGG + Intronic
917438966 1:175049504-175049526 CTGAATAAAGGGCAGAGCAATGG - Intergenic
918011391 1:180590210-180590232 GTGAATCAAAGCCAGCTCCTCGG + Intergenic
918130707 1:181626013-181626035 GGGAATGAATGGCAGGTCAATGG + Intronic
918670944 1:187216054-187216076 TAGAATAAAAGGCAGCAGAAGGG + Intergenic
919136313 1:193512276-193512298 GTCAATACTAGGCAGATCAATGG - Intergenic
920651976 1:207844514-207844536 GAGAAGAAAAGGCAGTTGAATGG + Intergenic
924665417 1:246066261-246066283 GCTAATAAAAGGCAGCTTAGTGG + Intronic
1065761707 10:28988838-28988860 GTGAATACAATACAGATCAACGG - Intergenic
1066971205 10:42313634-42313656 TTGAATAGAAGGCAGTTGAATGG - Intergenic
1072188291 10:93061924-93061946 GTGATCAAAAGGCAGCTGGAAGG + Intronic
1078849435 11:15150590-15150612 GTGAATAAATAGCAGCACAAAGG + Intronic
1078964306 11:16320121-16320143 GTGAATGCAAGGCTGCTGAAGGG - Intronic
1079484520 11:20921356-20921378 ATGAATTAAAGCAAGCTCAAAGG - Intronic
1079768583 11:24428330-24428352 GTAAATAAATGGCAGATAAATGG - Intergenic
1079936859 11:26627495-26627517 CTGAAGAAAATGCAGCTCAGAGG - Intronic
1080981352 11:37410700-37410722 GTAAATAACAAGCAGTTCAATGG + Intergenic
1082758549 11:57103117-57103139 GAGACTAAAAGGGATCTCAAGGG - Intergenic
1087700311 11:101429849-101429871 GTTAACAAAAGGCAGCTAAGTGG + Intergenic
1088402257 11:109434159-109434181 GTTAATAAAAGGGAGTTCAAAGG + Intergenic
1088743541 11:112786092-112786114 GTTAAGAAAAGGCAGGTGAATGG + Intergenic
1089301137 11:117499231-117499253 GGAAATAAAAGGCAGCTCTGTGG + Intronic
1095905638 12:47374882-47374904 GGAAATAAAAGGCATCTAAATGG + Intergenic
1096275372 12:50202978-50203000 GTGAATAAATGGCATTTGAAAGG + Intronic
1098178782 12:67822523-67822545 GAGAATGAAAGCCTGCTCAAAGG + Intergenic
1101200109 12:102426910-102426932 GTGAATAAAAAGAATGTCAAAGG - Intronic
1102675863 12:114658342-114658364 GGGAATCAAAGGAAGCTGAATGG - Intergenic
1106688146 13:32084219-32084241 GTGAATAAAAGGAAGAATAAGGG + Intronic
1107833432 13:44394668-44394690 GTGGATAATAGGTACCTCAAAGG - Intronic
1107922070 13:45219042-45219064 TTAAAAAAAAGGCTGCTCAAAGG + Intronic
1108029136 13:46210791-46210813 GAAAATAAAAGGCAGCTCTGTGG - Intronic
1108349922 13:49582584-49582606 GTGAATGAAAGCCAGTTTAAAGG + Intronic
1110539410 13:76690900-76690922 GGGGAAAAAAGGAAGCTCAAAGG + Intergenic
1111547114 13:89754021-89754043 GTGAATATAAGGTTGCTTAATGG + Intergenic
1119948256 14:78717320-78717342 GTCATTAAAAGGCAGCTGATTGG + Intronic
1120791047 14:88582421-88582443 GAGATTAAAAGGCAAATCAAAGG + Intronic
1121377638 14:93429129-93429151 ATGACTAAAAGAAAGCTCAATGG - Intronic
1125505025 15:40262815-40262837 GTTAATGAAAGACAGCTCATAGG - Intronic
1127831069 15:62752022-62752044 GTCTATAAAAGGCAACTCATGGG - Intronic
1128039037 15:64554046-64554068 ATAAATAAAAGGCATCTAAATGG - Intronic
1130164427 15:81438187-81438209 GTGAACCAAAGGCAAATCAAAGG - Intergenic
1135941303 16:26824537-26824559 GTGAATACAAGTCAGGTCTAAGG - Intergenic
1140906163 16:79411072-79411094 GTGAATAAAGGCAAGATCAAAGG - Intergenic
1143684307 17:8501673-8501695 AAAATTAAAAGGCAGCTCAAAGG + Intronic
1144799818 17:17918340-17918362 AGAAATAAAAGGCATCTCAATGG - Intronic
1149103054 17:52928856-52928878 GTGTATACATGGGAGCTCAAAGG + Intergenic
1149536796 17:57439480-57439502 ATGAATGAAAGTCACCTCAAGGG - Intronic
1150305145 17:64078338-64078360 GTTAAAAAAAGACAGCCCAATGG - Intronic
1155739682 18:29272687-29272709 GTGAATGAGAGGGAGCTGAAAGG - Intergenic
1156201823 18:34841955-34841977 ATAAATAAACTGCAGCTCAAGGG + Intronic
1156254739 18:35384133-35384155 GGGAACAAAAGGCAGAACAATGG - Intergenic
1156489194 18:37486266-37486288 GGGAATTAAAGGCAGAGCAAGGG - Intronic
1157347778 18:46855325-46855347 GTGAATAAAAAGCAACTTACAGG + Exonic
1157978273 18:52351164-52351186 GTAAAAAAAAGTGAGCTCAAAGG + Intronic
1158037136 18:53046250-53046272 GTGACTCAAAGGCAGTTTAAGGG - Intronic
1160108110 18:75998361-75998383 GTGAATCAAAGAAATCTCAAAGG - Intergenic
1160156522 18:76438060-76438082 TTGAATGATATGCAGCTCAACGG + Intronic
1165365306 19:35361699-35361721 GGGAATAAGAGGCAGCTTCATGG + Intergenic
1166027525 19:40101959-40101981 ATGAATAAAAGGCGTATCAATGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167243208 19:48357678-48357700 CTTTCTAAAAGGCAGCTCAATGG + Intronic
1167620277 19:50556544-50556566 GTGAAGAAAAGGAAGTGCAAGGG - Intronic
1168356078 19:55700835-55700857 GGGAATGAAAGGTAGCTCAGAGG + Intronic
928077641 2:28279637-28279659 GTGCAGACAGGGCAGCTCAAAGG + Intronic
932358059 2:71082927-71082949 GTAAATAAAATGCAGGCCAATGG + Intergenic
932910837 2:75804728-75804750 GTGAATAAAAGGTAATTCCAAGG - Intergenic
933362371 2:81304563-81304585 GTGTCTAAAAGGCAGGTCCAGGG + Intergenic
933850870 2:86365501-86365523 GAGAAGCAAAGGCAGCTCCAAGG - Intergenic
933887441 2:86732163-86732185 GTCTATAAAAGGCAGTTTAAAGG - Intronic
933922734 2:87064550-87064572 GTCTATAAAAGGCAGTTTAAAGG + Intergenic
935034985 2:99361701-99361723 GTAAACAAAAGGAATCTCAAAGG + Exonic
939666054 2:144952853-144952875 GAGAATAAGAGGCAGATCCAGGG - Intergenic
939761576 2:146188563-146188585 GTGAATAAAAGGCATATTGAGGG + Intergenic
940224172 2:151384409-151384431 GTGATTACCAGGCAGCACAAAGG + Intergenic
941981428 2:171461838-171461860 GTGAAAAAAAAGCAGATCACTGG - Intronic
943181018 2:184541118-184541140 GTGACTAGAAGGGAGCACAAGGG - Intergenic
947077087 2:226356321-226356343 GAGAATAAGAGGCAGCTGCAGGG - Intergenic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1177925584 21:27210625-27210647 GTCAAAAAAAGGAGGCTCAAAGG - Intergenic
1178781061 21:35603773-35603795 GTGAATAAAACACAGCTCCAGGG + Intronic
1183372542 22:37442190-37442212 GTGAAAAAAAGGGAGCTCTTTGG - Intergenic
949228283 3:1720042-1720064 GTGAATAGAAGGCAGCAAGAAGG + Intergenic
953593793 3:44287912-44287934 GTGAATAAAAGGCAGCTCAAGGG - Intronic
955101622 3:55855178-55855200 ATGACTAAAAGGCATCTCAGAGG + Intronic
955209858 3:56930429-56930451 AGGAATGAAAGGCAGCTGAAGGG + Intronic
957107670 3:75911489-75911511 GTCAATAAAAGGCAGAACTAGGG - Intronic
958581150 3:96024794-96024816 GTGTTTAACAGGCATCTCAAAGG - Intergenic
960341746 3:116483283-116483305 GTAAATAAAAAGGAGCACAATGG - Intronic
964143995 3:153436404-153436426 AGGAGAAAAAGGCAGCTCAAGGG - Intergenic
964245320 3:154645438-154645460 GTGTATAGAAGGCAGATCAATGG + Intergenic
964416313 3:156451940-156451962 GTGAACATAAGGCAGATAAAAGG - Intronic
967487072 3:190045438-190045460 ATGAATAAAAGGCAGCAAACAGG - Intronic
968431034 4:558928-558950 GTGAGCAGAAGGCAGGTCAAAGG + Intergenic
969563017 4:7961360-7961382 GTGAAGAAGAGGCAGCTGCATGG - Intergenic
970544330 4:17112046-17112068 AAGAATAAAAGAGAGCTCAAGGG + Intergenic
971417224 4:26442866-26442888 GTGAAGAAAAAGCAGGTCAAGGG - Intergenic
971469437 4:27004758-27004780 GTCAATAAAAGGCGGTTTAAAGG + Intronic
972574378 4:40338540-40338562 GTGAATGAGGGGCAGCTCAGGGG + Intronic
973306402 4:48657470-48657492 GTGAATAATTGGCAGGTTAAGGG - Intronic
975596858 4:76055555-76055577 GGGAGTGAAAGGCATCTCAAAGG + Intronic
975696151 4:77015297-77015319 TTTCATAAAAAGCAGCTCAAAGG + Intronic
976192943 4:82506012-82506034 GTGATTAAATGGCATCTCTAGGG + Intronic
982204536 4:152987956-152987978 ATTAACAAAAGGCAGCTCATTGG + Intergenic
982897639 4:160953509-160953531 CTGAATAAAAGTGAGCTCTAGGG + Intergenic
983630777 4:169847169-169847191 TTGAAAAAAAGTCATCTCAAAGG + Intergenic
985480118 5:104733-104755 GTGGTTGAAATGCAGCTCAAAGG - Intergenic
987093658 5:14529480-14529502 GTGAACAAATGGAAGCTCATGGG + Intronic
987226279 5:15844910-15844932 ATGAATATAAGAAAGCTCAATGG + Intronic
987236034 5:15942665-15942687 GTATATAAAACCCAGCTCAAGGG - Intergenic
988203932 5:28109441-28109463 GTAAGTAAAAGGCAGCACATTGG + Intergenic
989015465 5:36926606-36926628 GTGAATAAAATGCAGCAGAAAGG - Intronic
989682871 5:44049819-44049841 GTTAATTAAATGCAGTTCAATGG + Intergenic
989965284 5:50459770-50459792 GTGACTAAAAAGCAACTCAGAGG - Intergenic
990658982 5:57991402-57991424 GTGTATATAAGGCATGTCAAGGG + Intergenic
991984451 5:72269539-72269561 TTGAATGAAAGGCAGATCAGTGG + Intronic
996691317 5:126343215-126343237 TTGAATAAAAGTGAGCTAAAAGG - Intergenic
996820228 5:127618566-127618588 GGGAAAAAAAGCCAGGTCAATGG - Intergenic
999061609 5:148641629-148641651 GTGAAGAAAAAGAAGCTCAAGGG - Intronic
1000365633 5:160488219-160488241 GTGCATAAAAGTCAGCCAAAGGG - Intergenic
1000419287 5:161019895-161019917 GTAAATAAAAAACAGCTAAAAGG + Intergenic
1000772545 5:165373901-165373923 GTGATTAAAATGCAGCTGGATGG + Intergenic
1004299416 6:14443804-14443826 GTCAACAATAGGCAGCTCAGTGG - Intergenic
1012426876 6:99124426-99124448 GTGAATATCAGGCAGCCAAAAGG - Intergenic
1013355248 6:109340700-109340722 GTGAATAAAAGACAGCACTCAGG + Intergenic
1013591487 6:111622682-111622704 GTGAATGACCGGCAGCTCCAGGG + Intergenic
1013872268 6:114779258-114779280 GTTCATTAAAGGCAGATCAAGGG - Intergenic
1014596056 6:123340326-123340348 ATAAATAATAGGCAGATCAATGG - Intronic
1017832586 6:158144656-158144678 TTGGAAAAAAGGAAGCTCAAAGG + Intronic
1019986212 7:4657934-4657956 GTGAATACAAGGAACTTCAATGG - Intergenic
1020213732 7:6173183-6173205 GTGCAGGAAGGGCAGCTCAAGGG + Intronic
1021184947 7:17553502-17553524 AGGAATAAAAGGCAGATCAGTGG + Intergenic
1025873254 7:65455131-65455153 GTGAATACAATACAGCTCATAGG + Intergenic
1027361910 7:77417489-77417511 GTGAATAAAAGGAAGGCCACTGG + Intergenic
1030928671 7:115493664-115493686 GTGTGTAAAAGGCAGCTGCAAGG + Intergenic
1031204850 7:118743749-118743771 GTGAATTAAAGGGATGTCAAAGG + Intergenic
1033322148 7:140349594-140349616 GGGAATAACTGGCAGCTCCAGGG - Intronic
1033690246 7:143729286-143729308 GTGAATAAAAGGAAGAACCAGGG + Intronic
1035139548 7:156744533-156744555 GTAAATAATAGGCATCTAAAAGG - Intronic
1035637830 8:1160449-1160471 CTGAATAAAAAGCACCTCCAAGG - Intergenic
1038385084 8:27136402-27136424 GTGAAAAAAATGAAGGTCAAGGG + Intergenic
1039634165 8:39144828-39144850 ATGAATAAAAGGCATCCTAATGG + Intronic
1040122912 8:43702077-43702099 GGGTTTAAAAGGCAGATCAAGGG + Intergenic
1043352044 8:79373286-79373308 GTGAACAAAAAGCAGCAGAATGG + Intergenic
1043630718 8:82328462-82328484 CTGAAAGAAAGGCAGCACAAAGG + Intergenic
1044392804 8:91671929-91671951 ATGAATAAAAGACAGATCAGAGG + Intergenic
1045372176 8:101535408-101535430 GTGAATCCAAGGCAGGACAAAGG + Intronic
1046090959 8:109502184-109502206 GTGAGAAAAATGCAGGTCAAAGG - Intronic
1049339394 8:142103982-142104004 GTGTATAAAATACAGCTCCAAGG + Intergenic
1055733214 9:79300330-79300352 TTGAATAAAAAGCAACTGAAGGG + Intergenic
1056993739 9:91435461-91435483 GTACATAAAAGGCCACTCAAAGG + Intergenic
1059017308 9:110533290-110533312 GTGAATAAAAGCTTGCTAAAGGG - Intronic
1186566319 X:10666702-10666724 GTGAAGAAAAGGGAGCTCAGAGG + Intronic
1187107877 X:16262812-16262834 GTGAATAACAGGTATCACAATGG - Intergenic
1188922630 X:35996173-35996195 GTGAGTAAAAGGCAGCCATAGGG + Intergenic
1189263851 X:39698720-39698742 TTTAGTAAATGGCAGCTCAAAGG + Intergenic
1189732031 X:44031350-44031372 GGGAATACAAGACAGCTAAAGGG + Intergenic
1190035218 X:47016615-47016637 CTCAATAAAAGGCATATCAAAGG + Intronic
1190204108 X:48388385-48388407 CTGAATAAAAAGTAGCTTAAGGG + Intronic
1190206428 X:48407018-48407040 CTGAATAAAAAGTAGCTTAAGGG - Intronic
1190209367 X:48432594-48432616 CTGAATAAAAAGTAGCTTAAGGG + Intergenic
1192384460 X:70652103-70652125 CTGAATAGAAGGCAGCACAATGG + Intronic
1193334346 X:80270763-80270785 GTGAATTACATCCAGCTCAATGG - Intergenic
1194152927 X:90348036-90348058 GTGAATAAAAGACAAGTAAAAGG + Intergenic
1194655728 X:96570968-96570990 GTGAATAAAAGGCACTTCCAAGG - Intergenic
1196259547 X:113562078-113562100 GTAAATAAAAGGCAGCTCATAGG + Intergenic
1197086688 X:122485085-122485107 GAGATTCAAAGGCAGGTCAATGG + Intergenic
1197320292 X:125020653-125020675 GTGATTTAAATGCAGCCCAATGG - Intergenic
1199829486 X:151535300-151535322 GTGATGCTAAGGCAGCTCAAAGG + Intergenic
1200499271 Y:3924832-3924854 GTGAATAAAAGACAAGTAAAAGG + Intergenic
1200616873 Y:5389394-5389416 GTGAATAAAATTCAGAACAAAGG + Intronic
1201060841 Y:10045245-10045267 GTCAATAACAGGCAGCTGAATGG + Intergenic
1202111015 Y:21420705-21420727 GTCAGTAACAGGCAGCTGAATGG + Intergenic
1202117449 Y:21483481-21483503 GTCAGTAACAGGCAGCTGAATGG - Intergenic
1202194896 Y:22290138-22290160 GTCAATAACAGGCAGCTGAGTGG + Intergenic
1202200102 Y:22337283-22337305 GTCAATAACAGGCAGCTGAGTGG - Intronic
1202233420 Y:22679801-22679823 GTCAATAACAGGCAGCTGAGTGG - Intergenic
1202309736 Y:23516357-23516379 GTCAATAACAGGCAGCTGAGTGG + Intergenic
1202561065 Y:26154236-26154258 GTCAATAACAGGCAGCTGAGTGG - Intergenic