ID: 953595986

View in Genome Browser
Species Human (GRCh38)
Location 3:44314486-44314508
Sequence ACAACAAATAAGTGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953595985_953595986 12 Left 953595985 3:44314451-44314473 CCAATATGAGGACGCTGAGGTTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 294
953595984_953595986 13 Left 953595984 3:44314450-44314472 CCCAATATGAGGACGCTGAGGTT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953595986 Original CRISPR ACAACAAATAAGTGTAAAGC AGG Intronic
900812089 1:4812937-4812959 ACAACATATCAGAGTAAAGATGG + Intergenic
904414139 1:30345483-30345505 AAAAAAAAAAAGTGTAGAGCAGG + Intergenic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
907534591 1:55138379-55138401 AGAACAAATAAGAGTAAAGCAGG - Intronic
908777521 1:67655594-67655616 ACAGCAAACAATTATAAAGCTGG + Intergenic
908830592 1:68174616-68174638 ACAACACAAGAGTGTTAAGCTGG + Intronic
909866174 1:80674816-80674838 AAAAAAAATAAGTGTAAAAGGGG - Intergenic
910634589 1:89393482-89393504 ACAACAAAAATTTGAAAAGCAGG + Intergenic
911873984 1:103135561-103135583 ACAAGAAGTAAGAGTAAAGTTGG + Intergenic
911887583 1:103324366-103324388 ACAACAAAAAATTAAAAAGCAGG - Intergenic
911923542 1:103797311-103797333 ACAACAAAAAAGTGAGAAGGTGG - Intergenic
913594477 1:120360253-120360275 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914092787 1:144518733-144518755 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
914305743 1:146415142-146415164 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914596313 1:149157664-149157686 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
915684642 1:157619096-157619118 ACAACAGAGAAGAGTAAAGAAGG + Intergenic
916100382 1:161389173-161389195 ACAGAAAGTAAATGTAAAGCAGG + Intergenic
917143417 1:171861353-171861375 ACTACAAATCAGTGTAATACTGG + Intronic
917497650 1:175555906-175555928 ACAACAGATTCATGTAAAGCTGG - Intronic
919270979 1:195344583-195344605 ACAACAAACAACTGTAGAGCAGG - Intergenic
919945047 1:202312930-202312952 AGAAAAAAAAAGTGTAAGGCCGG + Intronic
920311635 1:205052198-205052220 ATAACCAATAACTGGAAAGCAGG + Intronic
921623101 1:217348273-217348295 ATAACAAATAAATGAAAAGAGGG - Intergenic
921734706 1:218613764-218613786 ACAGCAAATAAGTATAGAGGAGG - Intergenic
922060004 1:222079829-222079851 CCAACAAATAAGTCATAAGCTGG + Intergenic
924805847 1:247360959-247360981 ACAACAAAAAAGTGAACAGATGG + Intergenic
924862822 1:247943538-247943560 ACATCAAATTATTGTAAATCTGG - Intronic
1063373328 10:5536276-5536298 TCAACAAATAATTGTAAGACTGG - Intergenic
1063711708 10:8485206-8485228 ACAACAAATGAGTTCACAGCAGG - Intergenic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1065395543 10:25232935-25232957 GAAACAAATAAGAGTAAGGCTGG + Intronic
1066496499 10:35947465-35947487 ACAAAAACTAGGTGTAAGGCTGG - Intergenic
1067686668 10:48469929-48469951 ACCACAAATAAGTGGGAAGCTGG - Intronic
1067912837 10:50364429-50364451 ACAACCAGAAAGTGAAAAGCAGG - Intronic
1069229734 10:65994899-65994921 ACAAGAAATAATTTTATAGCAGG - Intronic
1070764062 10:79046444-79046466 AAAAAAAAAAAGAGTAAAGCTGG + Intergenic
1071708811 10:88028508-88028530 ACAATAAATAAGTGCAGATCTGG + Intergenic
1071799253 10:89041075-89041097 ACAACAAAAAAGTTTAAAAATGG - Intergenic
1071896519 10:90073905-90073927 ACAACAAAGAATTGAAAAGTGGG - Intergenic
1074747151 10:116546144-116546166 AAAACAAATAAATGTTGAGCTGG + Intronic
1075195165 10:120350317-120350339 ACAACAAAAAATTGAAAAGTAGG + Intergenic
1075290312 10:121224171-121224193 ACAACAACTAAATGTAAAGTGGG + Intergenic
1075496578 10:122925026-122925048 ACAACAAAAAATTTAAAAGCAGG + Intergenic
1079204223 11:18399889-18399911 AAAACATTTAAGTCTAAAGCCGG - Intronic
1079550558 11:21692099-21692121 AGAACAAATAAACCTAAAGCGGG + Intergenic
1079603192 11:22336163-22336185 ACAACAAATATTTGTGAAGCTGG - Intergenic
1079787486 11:24692347-24692369 AAAACAAATAAGTCACAAGCAGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1080891517 11:36412625-36412647 ACAAGAAAGAAGAGAAAAGCTGG - Intronic
1081016036 11:37882126-37882148 CCCAAAAATAAGTGTAAAACAGG - Intergenic
1081467429 11:43334557-43334579 ACAAAAAATCAAGGTAAAGCTGG + Intronic
1084297100 11:68219713-68219735 ACCACAAATAACTGTAAAGGAGG - Intergenic
1085178730 11:74513666-74513688 ACAACAAAAAAGTTTAAAAGTGG + Intronic
1085925748 11:81018527-81018549 TCAACAAATAATTATTAAGCTGG - Intergenic
1086744409 11:90406954-90406976 ATAAAAGATACGTGTAAAGCAGG + Intergenic
1087117580 11:94541985-94542007 ACATCAAATAAGGGTATAGTAGG + Intergenic
1088360895 11:108989004-108989026 AAAAAAAATCAGTGAAAAGCAGG + Intergenic
1091594555 12:1867957-1867979 ACAAGAAATAAGTGTAGACAAGG + Intronic
1091914354 12:4258167-4258189 AAAGCAAATAAGTTTAAAGATGG - Intergenic
1093183414 12:15992694-15992716 AGAAAAGAGAAGTGTAAAGCAGG + Intronic
1093589901 12:20889838-20889860 ACAACAAATCAGTGCCAAGAGGG - Intronic
1093978706 12:25452337-25452359 AGAACAGAGAAGAGTAAAGCAGG + Intronic
1094163354 12:27416564-27416586 ACAACAAAAAGCTCTAAAGCAGG + Intronic
1094380539 12:29838561-29838583 ACAACAAAAAGGTAAAAAGCAGG - Intergenic
1094686800 12:32725292-32725314 ACAACAAATAACTTGAAAACAGG + Intronic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1098137740 12:67420413-67420435 TCAACAAATAACTGTAAAAATGG - Intergenic
1098474312 12:70882492-70882514 ACAAGAAATAAGAGTCAAGGAGG + Intronic
1100527546 12:95433630-95433652 AATACAGATTAGTGTAAAGCAGG + Intergenic
1102319322 12:111917801-111917823 AAAACAAATAAGAAGAAAGCAGG - Intergenic
1102864414 12:116362544-116362566 AGAAAAAATTAGTGTATAGCTGG + Intergenic
1103353407 12:120301771-120301793 ACAAAAAATAAGAGAAAAGATGG + Intergenic
1107008027 13:35637068-35637090 ACAACAAATGAGAGAAATGCTGG - Intronic
1107350744 13:39512179-39512201 ACAGGAAATCAGTGTTAAGCAGG - Intronic
1108633023 13:52304584-52304606 ACAACAAAAAAGTTTAAAATAGG + Intergenic
1108653668 13:52507971-52507993 ACAACAAAAAAGTTTAAAATAGG - Intergenic
1108688422 13:52840945-52840967 TCAACTAATAAGTGAACAGCAGG - Intergenic
1109588231 13:64438669-64438691 TCAACAAATATGTGTAAAGAAGG - Intergenic
1111099387 13:83562767-83562789 ATAATAAATAAGAGTAGAGCTGG - Intergenic
1112539737 13:100296917-100296939 ACAACAACTAAATGCAATGCAGG - Intronic
1112818751 13:103305899-103305921 ACCACAAAGAAGTATAAAGCTGG + Intergenic
1114947876 14:27709417-27709439 ACAAATCATAAGTGTAAAGGTGG - Intergenic
1115172958 14:30529326-30529348 ACAACAAATAAACATAAAGTGGG - Intergenic
1116017881 14:39428993-39429015 ACAACTAATAAGGATAAAGAAGG - Intronic
1117506651 14:56410872-56410894 AAAACAAATAAGTGAAAGGAAGG - Intergenic
1118886986 14:69875737-69875759 ACCACATTTAAGAGTAAAGCTGG - Intronic
1120100524 14:80439628-80439650 ACAACAAAAAGGTTTAAAGCAGG + Intergenic
1120383402 14:83811935-83811957 AAAGCATATATGTGTAAAGCTGG + Intergenic
1120651468 14:87138893-87138915 ACAGAAAATAATTTTAAAGCAGG - Intergenic
1120810577 14:88799236-88799258 ATAACAAAAAAATGTAAATCAGG + Intergenic
1121066387 14:90970939-90970961 ACAATAGATAACTTTAAAGCAGG + Intronic
1121365964 14:93310408-93310430 ACAAAAAAAAATTGTAAAGGGGG - Intronic
1121485187 14:94309395-94309417 AAAACAGATAAGTGTGTAGCTGG + Intronic
1122099403 14:99395240-99395262 AAAACAAATGCGTGTAATGCGGG - Intergenic
1126053007 15:44704511-44704533 ACAACAAAGAATTAAAAAGCAGG - Intronic
1126905603 15:53361238-53361260 ATGACAAATAAGTGTAAAGGAGG - Intergenic
1128209410 15:65884469-65884491 AAAACAAATATATGTAAAACTGG + Intronic
1128948712 15:71851774-71851796 GCAAGAACTATGTGTAAAGCTGG - Intronic
1131532195 15:93203229-93203251 ACAACAGAGAAGTGTTAAGTAGG - Intergenic
1132164977 15:99577714-99577736 ACAACAAATAAATGCAATGTGGG - Intronic
1133803163 16:9100857-9100879 ACAAGAAACAAGTCTGAAGCAGG - Intronic
1135129996 16:19845776-19845798 ATAACAAATAATTTTATAGCCGG + Intronic
1135987652 16:27195779-27195801 GCAACAAATAACTGGAAAGGGGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1144383931 17:14731075-14731097 ACAACAAATAAGTGCAATGTGGG - Intergenic
1144447546 17:15344870-15344892 ACATCAAATAAATGTATAGGGGG - Intergenic
1146086622 17:29836643-29836665 ACCACAAATAACTGAAAAGATGG - Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1146438761 17:32876304-32876326 AAAAGAAGCAAGTGTAAAGCCGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1149054412 17:52345832-52345854 ACAACAAAAAGTTGAAAAGCAGG - Intergenic
1150215641 17:63467432-63467454 ACAACAAATAAATGTGAATCCGG - Intergenic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1154085828 18:11304730-11304752 ACAACAAAAAATTAAAAAGCAGG - Intergenic
1155855091 18:30824018-30824040 ATGACAAATAAGTGTCAAACTGG + Intergenic
1155900551 18:31383880-31383902 AAAACAAATAATTGAAAAGCAGG - Intronic
1156092177 18:33485278-33485300 AAAAAAAATAAGGATAAAGCAGG - Intergenic
1156510447 18:37632074-37632096 ACAACACATCGGTGCAAAGCAGG - Intergenic
1157661081 18:49445522-49445544 AGGACAAATAAGTGAAAAACAGG + Intronic
1158129991 18:54141888-54141910 ACAACAGATCAGGGTAAAGAAGG + Intergenic
1158708243 18:59813932-59813954 AAAAAAAATGAATGTAAAGCTGG + Intergenic
1159531101 18:69656668-69656690 ACAAAATATAAGTGTAATGTTGG + Intronic
1159967320 18:74607940-74607962 ACTACAAATAAGGATTAAGCTGG - Intronic
1161192712 19:2967815-2967837 ACAAAAAACAAGGATAAAGCTGG - Intergenic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
1163789759 19:19299776-19299798 ACAAAAAAAAAATGAAAAGCTGG - Intronic
1164878244 19:31708427-31708449 ACAAGAAAAAGGTGCAAAGCAGG + Intergenic
1165852906 19:38860871-38860893 ACAACAAAAAAGAAGAAAGCAGG - Intergenic
926277216 2:11413459-11413481 AAAAAAAAAAAGAGTAAAGCAGG + Intergenic
926302093 2:11611834-11611856 AGAACAAATGAGTGGAAAACAGG + Intronic
926975451 2:18512307-18512329 ACAACATATGCCTGTAAAGCTGG - Intergenic
927361992 2:22246729-22246751 ACAACAAAAAAGCAGAAAGCAGG + Intergenic
927834839 2:26386745-26386767 ATAACAAATGATTTTAAAGCTGG + Intronic
928009110 2:27591703-27591725 ACAAAAAATAATTTTAAGGCTGG - Intronic
929087458 2:38182532-38182554 ACATCAAATAAGGGTAAAATTGG + Intergenic
929606099 2:43235274-43235296 ACAACAAAAAAGTGATAAGCTGG - Intronic
930626259 2:53700967-53700989 AAAATAAATAAGTTTAAAGTGGG - Intronic
931823806 2:65978758-65978780 ACAACAAATAACTGAAAATGGGG - Intergenic
932198972 2:69809203-69809225 AAAACAAATAAGTAAAAAGAAGG - Intronic
932832097 2:75000018-75000040 ACAAAAAACTATTGTAAAGCAGG - Intergenic
934311166 2:91866040-91866062 ACAACAAAAAAGAGTAATACAGG + Intergenic
936498107 2:113040522-113040544 AGAACTAATAAGTGCAAGGCTGG + Intronic
936811104 2:116403438-116403460 ACAACTAACAAGTATAAAGAGGG - Intergenic
938573105 2:132580632-132580654 AGAAGGAATAATTGTAAAGCTGG - Intronic
939013427 2:136873930-136873952 TCAGCAAACAAGTGTCAAGCTGG - Intronic
939377883 2:141393400-141393422 ACAAAGAATAAGTTTTAAGCAGG - Intronic
940433222 2:153619335-153619357 ACAATAAATAGTTTTAAAGCAGG - Intergenic
941251781 2:163174103-163174125 AAAACAAATAAGTTAAAATCTGG + Intergenic
943829718 2:192445108-192445130 ACAACAGAAAACTGTAAAGAAGG - Intergenic
943904957 2:193487224-193487246 ACAAAAAATAAGTTGAATGCTGG - Intergenic
945118582 2:206434929-206434951 ACAAAAATAAAGTGTAAAGTTGG + Intergenic
945569896 2:211453416-211453438 ACATCAAAAAAATTTAAAGCGGG - Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946773596 2:223114525-223114547 ATTACAAACAAGTGTAAAGTAGG + Intronic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
947196686 2:227574741-227574763 TGAATAAATAAATGTAAAGCTGG - Intergenic
947584010 2:231340906-231340928 ACAAAAAACAAGTGTAGGGCTGG + Intronic
1170301159 20:14886071-14886093 AGCACAAATAAATGTGAAGCAGG + Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1183990079 22:41591941-41591963 ATAAAAAATAACTGTAGAGCTGG + Intergenic
949832872 3:8235097-8235119 ACAATAAATAAGTTTAAAAACGG + Intergenic
951219458 3:20054092-20054114 AAAAAAAATAAGTCTAAAGCCGG - Intronic
951664836 3:25111393-25111415 ACAACAAATAAGGCTACAGGTGG - Intergenic
951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG + Intergenic
952005980 3:28842673-28842695 ACAACTAGTAACTGCAAAGCAGG - Intergenic
952306227 3:32148879-32148901 ACAACAGAAAGGTGTAAAGAAGG + Intronic
953238191 3:41124574-41124596 ACAACAACTAAATGTAATGCAGG + Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953699140 3:45182531-45182553 TCAAAAAATAAGTGTGAGGCCGG - Intergenic
954828629 3:53398708-53398730 AAAAAAAGTAAGTGAAAAGCTGG + Intergenic
955025267 3:55161385-55161407 TAAACAAATATGTGAAAAGCTGG + Intergenic
956321736 3:68005373-68005395 ACTATAATTAAGTGCAAAGCAGG - Intronic
958870642 3:99555043-99555065 ACAAATAATAAGTGTAAAAATGG + Intergenic
958931027 3:100208346-100208368 AAAAAAAAAAAGTGTAAAGGAGG + Intergenic
959077318 3:101762773-101762795 AAAACAAAATAGTATAAAGCAGG + Intronic
960001632 3:112737757-112737779 AAAACCAATTTGTGTAAAGCAGG - Intergenic
960181477 3:114585388-114585410 ACAAAAACTATGTGTAGAGCTGG + Intronic
961202623 3:125056344-125056366 ACAAGAAGTAGGTGAAAAGCAGG + Intergenic
961229334 3:125288213-125288235 TAAACAGATAAGCGTAAAGCAGG - Exonic
962293220 3:134154710-134154732 ACAACAAAAAAGTGAAAATGAGG - Intronic
963935298 3:151046177-151046199 ACACCAAATATGGGTAATGCAGG + Intergenic
964316333 3:155448342-155448364 ACTACAAATAAGTAGAAGGCTGG - Intronic
964397159 3:156257551-156257573 ACAATAAAGAAGTTTGAAGCAGG + Intronic
966869679 3:184282113-184282135 AAAAAAACTAAGAGTAAAGCAGG + Intronic
971144850 4:23965475-23965497 ACAATGAATAAGGGTGAAGCTGG - Intergenic
971754779 4:30693432-30693454 AGAACAAATAAATCTAAAGTGGG - Intergenic
971952254 4:33367752-33367774 ACAACAAATAAAATTAAATCAGG + Intergenic
972393274 4:38633351-38633373 TCAATAAATATGTGAAAAGCTGG - Intergenic
972888597 4:43525490-43525512 ACTACAAATAAGCATAAAGATGG + Intergenic
974087326 4:57275353-57275375 GTAACAAATATGTGTAAAGCAGG - Intergenic
974130199 4:57745276-57745298 ACTCCAAACAAGTGTAAAGGAGG - Intergenic
975050777 4:69862138-69862160 ACTGAAAACAAGTGTAAAGCTGG + Intergenic
976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG + Intronic
977382721 4:96296932-96296954 ACAATAAATAAGAGAAGAGCTGG + Intergenic
978432528 4:108648155-108648177 AGAAGAAAAAAGTGTAAAGATGG - Intergenic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
981926739 4:150148558-150148580 ACTATAAATAAGTGTAAGCCAGG - Intronic
982625964 4:157766776-157766798 AAAATAAATAAGTGAAATGCTGG + Intergenic
984004361 4:174291215-174291237 ACAACAAACAAGAGAAAAACAGG - Intronic
984829282 4:183956254-183956276 ACAAGAAATAAATTAAAAGCTGG - Intronic
987927677 5:24363917-24363939 AGAACAAAGAAGAGCAAAGCTGG + Intergenic
989129042 5:38086163-38086185 ATAACAAATAAGTATTAGGCAGG - Intergenic
989827256 5:45872421-45872443 TAAACAGATAATTGTAAAGCAGG - Intergenic
990148100 5:52785895-52785917 AATACAAATAAATGTCAAGCCGG - Intergenic
990159865 5:52925496-52925518 AGAACAAATAAATGAAAAACTGG - Intronic
990596219 5:57314941-57314963 ACAACAAAAAAAAGTAATGCAGG - Intergenic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
990861482 5:60332413-60332435 ACCACTAATAAGTGAAAAGATGG + Intronic
991534568 5:67653245-67653267 AAGACAAATCAGTGTAATGCAGG + Intergenic
992481145 5:77153561-77153583 AAAAAAAAAAAGAGTAAAGCTGG - Intergenic
992904770 5:81335256-81335278 ACAATAGATGTGTGTAAAGCAGG + Intronic
993947198 5:94129964-94129986 ACAACAAAAAAGTAGAAATCTGG - Intergenic
994741418 5:103624351-103624373 AAAACAAACAACTGTAAAGCTGG + Intergenic
995554475 5:113313367-113313389 ACAACAAAAACGTGTAGAGAAGG + Intronic
996156269 5:120106432-120106454 ACCATAAATAACTGTAAAGCTGG - Intergenic
996659657 5:125986730-125986752 ACAACAAAAAGTTGAAAAGCAGG - Intergenic
996666809 5:126069060-126069082 ACAACAAAAAATTAAAAAGCAGG + Intergenic
998259326 5:140616880-140616902 ACAAAAAATAAATGTTAGGCAGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999131478 5:149286845-149286867 ACAACCAGTAAGTGTGGAGCTGG + Intronic
1000565695 5:162844705-162844727 ACAACAATTAACTGGAAATCTGG + Intergenic
1000699538 5:164431245-164431267 ACAAAAAAGATGTTTAAAGCTGG - Intergenic
1001333003 5:170775405-170775427 ACTATAAAGAAATGTAAAGCTGG - Intronic
1001705628 5:173739335-173739357 ACAACAAAGAAGTGGTAAGCTGG + Intergenic
1003794007 6:9579713-9579735 ATTACAAATATGTGTAAGGCAGG - Intergenic
1004370608 6:15049114-15049136 ACACCAACTAAGTGGAAAGTCGG + Intergenic
1005220832 6:23586453-23586475 ATAACAAATAAATGTAAAAACGG - Intergenic
1006195529 6:32239111-32239133 TCAACAAATAAATGTCAAGGGGG - Intergenic
1006640602 6:35487764-35487786 ACAACAAAAAACACTAAAGCAGG + Intronic
1007047591 6:38793076-38793098 AGAACAAATAATTTTAAGGCTGG - Intronic
1007565711 6:42848838-42848860 AAAACAATTAATTATAAAGCAGG + Intronic
1008727386 6:54439207-54439229 ACAACAAAAAGTTATAAAGCAGG - Intergenic
1010505825 6:76657974-76657996 ACAAGAGATAAGTGTTAAGGAGG + Intergenic
1010852102 6:80789993-80790015 ATAACAAATAACTGGAAAGCTGG - Intergenic
1011126387 6:84012485-84012507 AAAACAAAAAAGTGTTAGGCTGG + Intergenic
1011341187 6:86315985-86316007 ACAACAAAAAATTAAAAAGCAGG + Intergenic
1011699576 6:89942969-89942991 AGAAAAAAAATGTGTAAAGCTGG - Intronic
1015143932 6:129964795-129964817 AGAACAAATAAGTGTCATGTGGG + Intergenic
1015460949 6:133489990-133490012 ACAACAAATAGTTAAAAAGCAGG + Intronic
1015651241 6:135463124-135463146 ACAAAAAAGAAGACTAAAGCAGG - Exonic
1017227316 6:152037083-152037105 TTAAGAAATAAATGTAAAGCAGG - Intronic
1018024262 6:159791260-159791282 ACAACAAATAGGTGTGATGGGGG + Intronic
1018538740 6:164853359-164853381 ACAAAAAATAAGTTTTTAGCAGG - Intergenic
1018739892 6:166720133-166720155 ACAACAAAACATTGTAAAGTGGG + Intronic
1018817210 6:167342666-167342688 ACAATAAAAAAGTTAAAAGCTGG + Intronic
1019456667 7:1131205-1131227 AAAAAAAAAAAGAGTAAAGCAGG + Intronic
1021209941 7:17837074-17837096 ACAAGAAATAAGTGTGAGGTGGG - Intronic
1025611620 7:63079677-63079699 AAAAAAAATAAGTGTAGACCAGG + Intergenic
1025981092 7:66407021-66407043 ACAACAAATAAGGGTGCAGAGGG - Intronic
1027205949 7:76099171-76099193 ACAACAAATAAGGGTGCAGAGGG - Intergenic
1027415473 7:77969264-77969286 ACAACATATCTGTGTAAGGCTGG + Intergenic
1027526738 7:79278664-79278686 ACAACAAACAAGGGTAAATGTGG + Intronic
1028017130 7:85730237-85730259 ACAACAGATAATTGTGACGCTGG + Intergenic
1028069265 7:86430883-86430905 CATACAAATCAGTGTAAAGCTGG + Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1030894772 7:115044610-115044632 TCAACATATCTGTGTAAAGCTGG + Intergenic
1031096812 7:117429925-117429947 TCAACAAATAGTTGTGAAGCAGG + Intergenic
1031566095 7:123298698-123298720 ACAACAAAAAGTTGAAAAGCAGG + Intergenic
1031755899 7:125642049-125642071 ACAATAAATAACTGTTAATCAGG + Intergenic
1032026755 7:128448974-128448996 TCAACAAATAAATATAAAACAGG + Intergenic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1034877024 7:154733442-154733464 ACTATAAAGAAGTGCAAAGCAGG - Intronic
1035155567 7:156909341-156909363 AGAAAAATTAAGTGTAAAGTAGG - Intergenic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036463007 8:8970910-8970932 GAAACAAAAAAGTCTAAAGCTGG + Intergenic
1037289287 8:17334503-17334525 ACAACAGATAGGTGAAAAGTAGG + Intronic
1037488943 8:19378415-19378437 ACAACAAAGAACTGTGAAGGTGG - Intronic
1038048200 8:23785045-23785067 AAAAAAAATAAATGAAAAGCAGG - Intergenic
1039071615 8:33653997-33654019 AAAACAAAGAATCGTAAAGCTGG - Intergenic
1039908541 8:41805721-41805743 AAAACAAATCAGTGCAAAGAGGG + Intronic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1041979076 8:63834714-63834736 ACAAAAAATAAGTTTAAAATAGG - Intergenic
1042052013 8:64720102-64720124 TCTACAAATAAATGTAAAGTGGG - Intronic
1042560254 8:70068633-70068655 ACAACAAATAAATATCAAACTGG - Intronic
1042589230 8:70380083-70380105 ACAGGAAACAAGTGTCAAGCAGG + Intronic
1043824879 8:84914781-84914803 ACTACAAATCAGGGAAAAGCAGG + Intronic
1045117972 8:99004401-99004423 ACAACAAATTACTGTAAACTGGG + Intergenic
1045203996 8:100017356-100017378 ACAACAAATGTGTGTAATGTAGG - Intronic
1047901322 8:129425318-129425340 ACAACAAAAAAGTTAAAAACTGG + Intergenic
1048059104 8:130899256-130899278 AAAACATATAAGTGTAATGAAGG - Intronic
1048072527 8:131037845-131037867 ATAACAAATAAGTCTCAATCTGG - Intronic
1048916974 8:139194499-139194521 TCAATAAATAAGTGTAGAGAAGG - Intergenic
1050906587 9:11013192-11013214 ACCACAAAAAATTATAAAGCAGG - Intergenic
1051162016 9:14219589-14219611 CCATAAAATACGTGTAAAGCAGG - Intronic
1052963145 9:34318111-34318133 AGAACAAACAAGTCTAAAGCTGG + Intronic
1053491685 9:38510853-38510875 AAAACAAATAAGAATAAAGGAGG + Intergenic
1058331923 9:103772645-103772667 ACAACAAATAATTGGTAAGTGGG - Intergenic
1058558246 9:106194306-106194328 ACAACAAAAACCTATAAAGCAGG - Intergenic
1058635410 9:107033558-107033580 TCAACAGATGAGTGTAAACCAGG - Intergenic
1059026925 9:110644636-110644658 ACAACAAATAATTGGAATTCAGG - Intergenic
1059098025 9:111439938-111439960 GCAACAAAGAAGAGAAAAGCTGG + Intronic
1059170619 9:112121213-112121235 AAAACAAAGAAGGGTAGAGCTGG - Intronic
1185989122 X:4873271-4873293 AAAATAAAAAAGTGAAAAGCTGG - Intergenic
1186562718 X:10630214-10630236 TCAACAAATAAGTAGAAAGTAGG + Intronic
1187750811 X:22462811-22462833 AAAACAAATAAAGGTAATGCAGG - Intergenic
1188064985 X:25648081-25648103 ACAAGAAACAAGAGTAAAGAGGG - Intergenic
1188467202 X:30495432-30495454 ACAACAGATAATTGAAAAACTGG + Intergenic
1188925464 X:36037326-36037348 ACAACAACAAAGAGTAAAGTTGG - Intronic
1189068697 X:37840274-37840296 ACAAAATATTAGTGAAAAGCTGG + Exonic
1189079093 X:37950463-37950485 AGAAATAATAACTGTAAAGCAGG + Intronic
1190365626 X:49691611-49691633 ATAACAGATAAGTGCAAAGGAGG - Intronic
1191789846 X:64958045-64958067 AAAAAAAATAACTGTAAAACAGG - Intronic
1191994588 X:67078728-67078750 ACAACAAAAAATTAAAAAGCAGG - Intergenic
1192088238 X:68123559-68123581 ACAACAAAAAACTGAAAAGTGGG + Intronic
1192303239 X:69928717-69928739 ACAGCACATAATTGTAAACCAGG + Intronic
1192971127 X:76231749-76231771 ACAACAAATAATTAAAAAGTGGG + Intergenic
1193448580 X:81638016-81638038 ACAACAAAAAGGTCAAAAGCAGG + Intergenic
1193631618 X:83896031-83896053 ACAACAAAAAGATGAAAAGCAGG - Intergenic
1194331484 X:92589419-92589441 ACAACAAAAATTTGAAAAGCAGG + Intronic
1194958279 X:100206525-100206547 ACAACAGATTAATGTAAAGGTGG + Intergenic
1194958311 X:100206926-100206948 ACAACAGATTAATGTAAAGATGG - Intergenic
1195584583 X:106551155-106551177 ACAACAAAAAGTTGAAAAGCAGG + Intergenic
1195848933 X:109262208-109262230 ACAACAAAATATTGAAAAGCGGG - Intergenic
1198080885 X:133238303-133238325 ACTACATATAAATGTAATGCTGG - Intergenic
1200364128 X:155643774-155643796 ACAACAAAAAATTTAAAAGCAGG - Intronic
1200640184 Y:5708473-5708495 ACAACAAAAATTTGAAAAGCAGG + Intronic
1200957855 Y:8969945-8969967 ACACCAACTGAGTGGAAAGCTGG + Intergenic
1201465841 Y:14279625-14279647 ACAATAAAAAACTCTAAAGCAGG + Intergenic