ID: 953597974

View in Genome Browser
Species Human (GRCh38)
Location 3:44336199-44336221
Sequence GTGTTAATACAGCTAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953597974 Original CRISPR GTGTTAATACAGCTAGAAGG TGG Intergenic
902690761 1:18109043-18109065 AGGCTAAGACAGCTAGAAGGAGG + Intronic
903578235 1:24352411-24352433 GACTGAAGACAGCTAGAAGGTGG + Intronic
907799556 1:57751252-57751274 GGCATAATATAGCTAGAAGGAGG + Intronic
907867904 1:58416714-58416736 GTGAGAACACAGCAAGAAGGTGG - Intronic
908454660 1:64291452-64291474 GTGAGGATACAGCAAGAAGGTGG - Intergenic
909539960 1:76780203-76780225 TTGATCATACAGCTAGAAAGTGG - Intergenic
909618734 1:77643639-77643661 GTGTTAAGACTGCAAGAAGTAGG - Intronic
912070921 1:105808200-105808222 TTGAAAATACAGCCAGAAGGGGG + Intergenic
913092391 1:115486423-115486445 GTGTGAGCACAGCAAGAAGGTGG - Intergenic
913247206 1:116880265-116880287 GTAAAAATACAGCTAGAAAGTGG + Intergenic
913690220 1:121272541-121272563 GAGTTAAGACAGCGAGAATGAGG + Intronic
916410977 1:164546528-164546550 TTATTAAGACAGCCAGAAGGTGG - Intergenic
916879696 1:169008236-169008258 TTATTAATATATCTAGAAGGAGG + Intergenic
916919510 1:169449283-169449305 GTTTTAATATGGCTAGGAGGTGG + Intronic
917265908 1:173220680-173220702 GTGAGGATACAGCAAGAAGGTGG + Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
920477540 1:206291028-206291050 GAGTTAAGACAGCGAGAATGAGG + Intronic
920659685 1:207905030-207905052 GTGTTATTTCATCTAGATGGGGG + Intronic
921565090 1:216707355-216707377 GTGTTCCTTCAGCTAAAAGGTGG - Exonic
921783986 1:219204337-219204359 ATGTTAATAAAGCCAGAAGAAGG - Intronic
922406568 1:225320194-225320216 GAGCTTATACAGCTAGAAAGTGG - Intronic
924824770 1:247527758-247527780 ATTTTCAAACAGCTAGAAGGAGG - Intronic
1063252795 10:4292524-4292546 GTGAGGACACAGCTAGAAGGTGG - Intergenic
1063514217 10:6678382-6678404 GTGGTAATGGAGCCAGAAGGGGG - Intergenic
1064123891 10:12642596-12642618 GTTTGCATACAGCCAGAAGGTGG + Intronic
1064358484 10:14641574-14641596 GTGAGAACACAGCAAGAAGGTGG - Intronic
1065231602 10:23604154-23604176 TTGTTAAAGCACCTAGAAGGTGG - Intergenic
1066380460 10:34896863-34896885 GTGTTGAGAAAGTTAGAAGGTGG + Intergenic
1068557567 10:58476301-58476323 GTGGTCACATAGCTAGAAGGTGG - Intergenic
1069938192 10:71934057-71934079 GTGAGAACACAGCAAGAAGGTGG - Intergenic
1072528350 10:96294872-96294894 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1079364339 11:19796304-19796326 GTATTATTACAGCAAGAAAGAGG + Intronic
1079944417 11:26724106-26724128 ATGTTAATATAGCGAGAAGGAGG + Intergenic
1080310856 11:30890054-30890076 GTGTGAACACAGCAAGAAGGTGG + Intronic
1080566128 11:33511065-33511087 GCGTCAGTACAGCTAGAATGTGG + Intergenic
1080655786 11:34257112-34257134 GTGTTAGTACAAATAGCAGGTGG + Intronic
1081265043 11:41010501-41010523 GTGTAAATAGAGCAAGAAAGTGG + Intronic
1081430875 11:42975328-42975350 GAGGAAATACAGCTAGAGGGAGG - Intergenic
1085491149 11:76918805-76918827 AAGTTCACACAGCTAGAAGGTGG + Intronic
1086057702 11:82666700-82666722 GGGTTAATTCAGCTACAAGATGG + Intergenic
1087612297 11:100448915-100448937 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1088405014 11:109465635-109465657 ATGTTAATCTAGCTAGAAGTTGG - Intergenic
1088816957 11:113427979-113428001 GTGGGAATGCAGCAAGAAGGCGG + Intronic
1091983680 12:4888530-4888552 GTGAGGATACAGCAAGAAGGGGG + Intergenic
1092561523 12:9619223-9619245 CTTTTAATATACCTAGAAGGGGG + Intergenic
1093351451 12:18107733-18107755 GTGTGCAGACAGCAAGAAGGTGG + Intronic
1093823265 12:23648600-23648622 GTGTGAACACAGAGAGAAGGTGG + Intronic
1095744904 12:45647147-45647169 GTGTTATCATAGCTAGAAAGAGG + Intergenic
1097338292 12:58409286-58409308 ATGTTACTATGGCTAGAAGGTGG + Intergenic
1097803298 12:63938607-63938629 GTGGTTAAACAGCTGGAAGGTGG + Intronic
1098918292 12:76279481-76279503 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1100593616 12:96052641-96052663 GTGAAGATACAGCAAGAAGGTGG + Intergenic
1100815712 12:98385200-98385222 GAGATCATACAGCTAGTAGGTGG - Intergenic
1103500286 12:121396491-121396513 GAGTTAATGCAGCTGGAAAGTGG - Intronic
1112169141 13:96951444-96951466 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1112603777 13:100883127-100883149 GCGGTAATACAGCTAGTAAGAGG - Intergenic
1114802310 14:25791354-25791376 GTGATAATATAGGTATAAGGTGG - Intergenic
1119599728 14:75967424-75967446 GGGTTAAGGCAGCTGGAAGGAGG + Intronic
1119685879 14:76630799-76630821 GTGAGAACACAGCGAGAAGGTGG + Intergenic
1119882551 14:78112524-78112546 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1120053416 14:79894987-79895009 GTGTTATTAAAGCTAGAAAAAGG - Intergenic
1120148553 14:81006368-81006390 GTGAGAACACAGCAAGAAGGAGG - Intronic
1121841017 14:97133895-97133917 GTGAGAACACAGCAAGAAGGTGG - Intergenic
1122708976 14:103641530-103641552 GTGAGAATACATCTAGAAGTCGG - Intronic
1125656981 15:41366118-41366140 GGTTTCAAACAGCTAGAAGGAGG - Intronic
1127906377 15:63379438-63379460 CTGTTCTTACAGCTAGAAGTGGG - Intronic
1129095654 15:73204892-73204914 ATGTTAATCCAGCTAGAAGTTGG + Intronic
1131630890 15:94175869-94175891 GTGAGAACACAGCAAGAAGGCGG + Intergenic
1131883233 15:96881029-96881051 ATGTTTATAGAGGTAGAAGGAGG + Intergenic
1133732016 16:8586149-8586171 ATGTTACTACCTCTAGAAGGAGG + Intronic
1134382608 16:13741921-13741943 GTGGTAACACAGTGAGAAGGTGG - Intergenic
1138903589 16:61303368-61303390 GTGAGAACACAGCAAGAAGGAGG + Intergenic
1140026277 16:71293103-71293125 GTGAGAATACAGCAAGAAGCTGG - Intergenic
1140596605 16:76423049-76423071 GTGAGACTACAGCTAGAAAGTGG + Intronic
1140654381 16:77124451-77124473 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1144020712 17:11238947-11238969 GAGTTAATACAGCAAGCAAGAGG - Intergenic
1144078480 17:11740441-11740463 GTGAGGATACAGCAAGAAGGTGG - Intronic
1147347609 17:39812754-39812776 CTCTTAATCCAGCTGGAAGGAGG + Intronic
1149436037 17:56634205-56634227 GTGTAGACACAGCAAGAAGGTGG - Intergenic
1150795884 17:68236531-68236553 ATGTTAATAATGTTAGAAGGAGG - Intergenic
1150806429 17:68322933-68322955 GTGAGAATACAGCAAGAAGGGGG - Intronic
1151853467 17:76705697-76705719 GTGAAAGTACAGCAAGAAGGTGG + Intronic
1153391646 18:4568587-4568609 GTGGAAATACAGCAAGAAGGTGG + Intergenic
1155906684 18:31460477-31460499 GTGGTAATGGAGATAGAAGGTGG - Intronic
1156183264 18:34630745-34630767 CTGTTCATGCAGCTGGAAGGTGG + Intronic
1157865753 18:51182956-51182978 GTGTTAATGGAACTAGAAAGTGG - Intronic
1157957131 18:52111030-52111052 GTGAAGATACAGCAAGAAGGAGG + Intergenic
1158791456 18:60784855-60784877 CTGTGAAAACAGCTAGGAGGGGG + Intergenic
1158870618 18:61683977-61683999 GTGAGAATACAGTGAGAAGGTGG + Intergenic
1159684478 18:71401237-71401259 GTGAGAACACAGCAAGAAGGAGG - Intergenic
1160928701 19:1559635-1559657 GTTTCAATACAGTCAGAAGGTGG + Intronic
1163230137 19:15996110-15996132 TTGTGAAAGCAGCTAGAAGGGGG + Intergenic
1166635341 19:44446398-44446420 GTGTTAATATAACTACAAAGTGG - Intronic
925594500 2:5542056-5542078 ATGATGATACAGCAAGAAGGTGG + Intergenic
926773260 2:16397087-16397109 GAGGGAATGCAGCTAGAAGGAGG + Intergenic
928063665 2:28140975-28140997 GTGAGGATACAGCAAGAAGGTGG - Intronic
930542453 2:52723905-52723927 GTGTCAAAACAGAGAGAAGGAGG + Intergenic
933193843 2:79367170-79367192 GTGGGGATACAGCAAGAAGGAGG + Intronic
936430729 2:112460003-112460025 GTGCTTATAGAGCTGGAAGGAGG + Intergenic
939660331 2:144881265-144881287 GTGAAATTACAGCCAGAAGGTGG - Intergenic
940059996 2:149554568-149554590 GAGTTAATACGGATACAAGGTGG + Intergenic
940291479 2:152081563-152081585 GTGAGAATATAGCTAGAGGGTGG - Intronic
942318913 2:174718845-174718867 GTGGTGATACAGCTTGCAGGGGG - Intergenic
943767625 2:191678891-191678913 ATTTTAATACATCTGGAAGGTGG - Intronic
944952734 2:204770784-204770806 GTGTTAATACAGGTGGAAGGTGG - Intronic
945562522 2:211356135-211356157 GTGATCAGACAGCTAGAAGCAGG + Intergenic
945636397 2:212357663-212357685 GTGTTAAAACAGATCGAAGGAGG - Intronic
947015274 2:225612652-225612674 GTGAGGATACAGCAAGAAGGTGG - Intronic
947155813 2:227162164-227162186 ATGTAAATACAGCAAGAAAGAGG - Intronic
947176690 2:227374297-227374319 GTGTTAATACGCCTTGAAGTCGG - Intronic
947246354 2:228053117-228053139 GTGATAACACAGCAAGAAGATGG - Intronic
948396150 2:237646733-237646755 GTGTGCACACAGCGAGAAGGTGG + Intronic
1168844619 20:935396-935418 GGGTTCACTCAGCTAGAAGGTGG - Intergenic
1168888594 20:1278365-1278387 ATTTCAATAAAGCTAGAAGGAGG - Intronic
1169773965 20:9231446-9231468 TAGTGAATACAGCAAGAAGGTGG - Intronic
1170406292 20:16041463-16041485 GTTTTAAAACAGCTAGAAACAGG - Intronic
1170474105 20:16697765-16697787 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1170920662 20:20676493-20676515 GTGTTCAAACAGCTAGCAAGGGG - Intronic
1171335189 20:24379243-24379265 GTGGAAAGACAGCTAGAAAGTGG - Intergenic
1172183401 20:33017017-33017039 GTGGTAAGACAGAGAGAAGGAGG - Intronic
1174992953 20:55533913-55533935 GTGTTAACAGAGCTAGGATGTGG - Intergenic
1176969302 21:15247588-15247610 GAATTAATACAGCAAAAAGGAGG + Intergenic
1177488714 21:21793274-21793296 GTTTTAAGATAGCTAGAAGGAGG + Intergenic
1177834623 21:26174389-26174411 GTGAGAATACAGGGAGAAGGTGG - Intergenic
1178165038 21:29964127-29964149 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1178464122 21:32831331-32831353 GGTTTCAAACAGCTAGAAGGAGG - Intergenic
1182996249 22:34815535-34815557 GTGGTCACACAGCTAGAAAGTGG + Intergenic
1184509418 22:44924590-44924612 GGGCAAATACAGCAAGAAGGTGG + Intronic
950308530 3:11935714-11935736 GTATTAACACAGGTAGAAGCTGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951158808 3:19389924-19389946 GTTTTAATACAGATACAAGCCGG - Intronic
952333761 3:32387408-32387430 GTGTGGACACAGCAAGAAGGTGG + Intergenic
952667902 3:35929533-35929555 GTATAAATACAGCTAGATGTAGG - Intergenic
953203545 3:40799678-40799700 GTGATGACACAGCAAGAAGGTGG + Intergenic
953242702 3:41163754-41163776 GTGTTAATAGAGCTTGGAGGAGG - Intergenic
953597974 3:44336199-44336221 GTGTTAATACAGCTAGAAGGTGG + Intergenic
956760365 3:72437973-72437995 GTGTTAATATACCTATAAGTTGG - Intronic
959052276 3:101535790-101535812 GAGTTAATACAGCCAGAAGGTGG + Intergenic
959784183 3:110273793-110273815 GTGAGAACGCAGCTAGAAGGTGG - Intergenic
960031641 3:113060165-113060187 ATGCTAATACAGCCAGGAGGTGG + Intergenic
961406376 3:126682486-126682508 GAGGTCATGCAGCTAGAAGGAGG - Intergenic
963659670 3:148109265-148109287 GTGTTAATACAGAGAGCAGCTGG + Intergenic
964984270 3:162719704-162719726 GTGAAAATACAGCTAGAGGATGG + Intergenic
967616404 3:191573370-191573392 GTGAGGATACAGCAAGAAGGTGG + Intergenic
967744826 3:193043489-193043511 GTGAAAACACAGCAAGAAGGAGG - Intergenic
968439311 4:613589-613611 GTGAGGATACAGCGAGAAGGTGG - Intergenic
969712185 4:8850633-8850655 GTGTGAACACAGGTAGGAGGTGG - Intronic
971637425 4:29079448-29079470 GTGAGAACACAGCCAGAAGGTGG - Intergenic
971894441 4:32573733-32573755 GGTTTCAAACAGCTAGAAGGAGG - Intergenic
974175032 4:58310345-58310367 ATGTTGATACAGACAGAAGGCGG - Intergenic
975341302 4:73244049-73244071 GTGGGGATACAGCAAGAAGGTGG - Intronic
976971208 4:91104772-91104794 GTGAGAACACAGCAAGAAGGTGG - Intronic
977326469 4:95580518-95580540 GTGATGCTACAGCTTGAAGGGGG - Intergenic
978735616 4:112080863-112080885 GTGATAATACAGCCTGTAGGAGG + Intergenic
978932992 4:114339135-114339157 GTGAGAATACAGCAAGAATGTGG + Intergenic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
980453064 4:133000111-133000133 GTGTTAATTTAACTAGAAGTTGG - Intergenic
981136416 4:141215394-141215416 GAGTTAAGACAGCAAGAAAGAGG + Intergenic
982954979 4:161752888-161752910 GTGACAATGCAGCAAGAAGGCGG + Intronic
983119334 4:163860834-163860856 GTGTTATTCCGGCTAGAAGTTGG - Intronic
985084154 4:186295951-186295973 GTTTTAATACCCCGAGAAGGAGG - Intergenic
987603876 5:20107918-20107940 GTGTGAACACAGCAAGAAAGGGG - Intronic
988324801 5:29749746-29749768 GGATTCAAACAGCTAGAAGGAGG - Intergenic
988450070 5:31332962-31332984 CTGCTAAGAGAGCTAGAAGGAGG + Intergenic
989642614 5:43597999-43598021 GTTTTGCTACAGCTAAAAGGAGG + Intergenic
990597846 5:57329318-57329340 GTGGGAACACAGCAAGAAGGTGG - Intergenic
993207780 5:84906561-84906583 ATGTTAATCCAGGTAGAAGTTGG - Intergenic
993384739 5:87251275-87251297 GTGTTAAAACAGCTCAGAGGAGG + Intergenic
994627361 5:102237316-102237338 GTGTTAACAAATCTAGATGGTGG - Intronic
996031117 5:118704732-118704754 GTCTTCAGGCAGCTAGAAGGAGG + Intergenic
996139767 5:119892466-119892488 GTGATGATACAGAGAGAAGGTGG + Intergenic
996722632 5:126644887-126644909 GTGATAACACAGCAAGAAAGTGG + Intergenic
997657455 5:135566099-135566121 GTGTTCACACAGCTAGCAGGTGG - Intergenic
1001697043 5:173678629-173678651 ATGGGAACACAGCTAGAAGGTGG - Intergenic
1002393636 5:178936466-178936488 GAGTTAAAACAGAAAGAAGGGGG - Intergenic
1002956852 6:1873991-1874013 GTGTAATTACAGCTTGCAGGAGG + Intronic
1004564918 6:16787305-16787327 GTGAGAACACAGCAAGAAGGTGG + Intergenic
1011060331 6:83258777-83258799 GAGTTCATACTGCTAGCAGGTGG + Intronic
1011348970 6:86401701-86401723 GTGTTAAAGCAGCCAGGAGGGGG - Intergenic
1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG + Intronic
1015731964 6:136358089-136358111 GAGTTAAAACTGCTAAAAGGAGG - Intronic
1017854200 6:158334872-158334894 GTGTGAGGACACCTAGAAGGTGG + Intronic
1020215066 7:6183902-6183924 GTGAGGATACAGCAAGAAGGCGG + Intronic
1020876386 7:13700009-13700031 GTGAGGATACAGCAAGAAGGTGG - Intergenic
1024036824 7:45513825-45513847 GTGAGGATACAGCAAGAAGGCGG + Intergenic
1025918621 7:65888903-65888925 GTGTCAAGTCAGCTAGAAAGAGG + Intronic
1027584724 7:80044258-80044280 GGGTAAATACAGATACAAGGAGG + Intergenic
1030529270 7:110692745-110692767 GTGTGAAAACTGCTAGAAGCAGG + Intronic
1032796334 7:135279321-135279343 GTGAGGACACAGCTAGAAGGTGG + Intergenic
1033421015 7:141204593-141204615 GTGTAAATACAGCTTGTGGGTGG + Intronic
1033881622 7:145890919-145890941 GTGAGAATACAGCAAGAAGATGG - Intergenic
1034592072 7:152149443-152149465 GTTTTAATATAGTTAGAAAGGGG - Intronic
1034919476 7:155068192-155068214 GTGAGAATAAAGCAAGAAGGTGG - Exonic
1037620402 8:20558506-20558528 GTGAAAATACAGCAGGAAGGTGG + Intergenic
1037732053 8:21534352-21534374 GTGTGGATACAACTAGAAGTTGG - Intergenic
1038431324 8:27502620-27502642 GTGAGGATACAGCAAGAAGGTGG - Intronic
1039192027 8:34986782-34986804 GTGAGAATACAGGGAGAAGGTGG + Intergenic
1039780033 8:40775945-40775967 GTGAGGATACAGCAAGAAGGCGG + Intronic
1041977884 8:63819750-63819772 GTGTGAACACAGTGAGAAGGTGG + Intergenic
1044065050 8:87688626-87688648 GTGTGAGTACAGCAAGAAGGTGG + Intergenic
1045750771 8:105481408-105481430 GTGTGCACACAGCTAGAAGGTGG - Intronic
1045754855 8:105530532-105530554 GTGTGGACACAGCAAGAAGGCGG - Intronic
1047546758 8:125825542-125825564 GTGTTATTCCAGCTCCAAGGCGG + Intergenic
1051148959 9:14060084-14060106 GTGAGAACACAGCCAGAAGGTGG - Intergenic
1051188394 9:14484969-14484991 GTGACAACACAGCAAGAAGGTGG - Intergenic
1052356202 9:27507211-27507233 GTGGTCATACAGCTAGTAAGTGG + Intronic
1053359497 9:37474239-37474261 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1054941043 9:70742452-70742474 TAGTTCAAACAGCTAGAAGGAGG - Intronic
1056080435 9:83087460-83087482 GTGAGAACACAGCTTGAAGGTGG + Intergenic
1056083952 9:83126307-83126329 GTGAGAATGCAGCAAGAAGGTGG + Intergenic
1058351206 9:104026541-104026563 GTGGTAATGCAGTTAGGAGGGGG + Intergenic
1059618560 9:115977699-115977721 GTGAGAATACAACAAGAAGGTGG + Intergenic
1187039079 X:15574243-15574265 GGGTTAATTCTGCCAGAAGGTGG - Intronic
1189478340 X:41374491-41374513 GTGAGAACACAGCGAGAAGGTGG + Intergenic
1190794996 X:53732592-53732614 TTGTCAATACAGCAAAAAGGTGG + Intergenic
1193013670 X:76707513-76707535 GTTTTCATAAAGCTAGAAGAGGG + Intergenic
1194821546 X:98512917-98512939 ATGGTAATTCAGCTAGAAAGTGG - Intergenic
1194920653 X:99760311-99760333 CTGTTAAAGCAGCTAGGAGGGGG + Intergenic
1196378157 X:115058377-115058399 GTGTTAATACAGCTATATTTTGG - Intergenic
1198835804 X:140803713-140803735 GTGAAAACACAGCTAAAAGGAGG + Intergenic
1200395185 X:155981963-155981985 GAGTTCATACAGTTAGAAAGTGG + Intergenic
1200852528 Y:7899249-7899271 GTGTTAATCTACCTGGAAGGTGG + Intergenic
1201470782 Y:14332710-14332732 GTGTTATCATAGCTAGAAAGAGG - Intergenic