ID: 953598349

View in Genome Browser
Species Human (GRCh38)
Location 3:44338533-44338555
Sequence CACCCTCCCCGCTCCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953598349_953598369 27 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598369 3:44338583-44338605 CAGCTGAGAATTCAGGGTTGGGG 0: 1
1: 0
2: 4
3: 22
4: 255
953598349_953598370 28 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598370 3:44338584-44338606 AGCTGAGAATTCAGGGTTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 246
953598349_953598359 -2 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598359 3:44338554-44338576 TGTTGGGGGCAGGTGGAGCCGGG 0: 1
1: 0
2: 3
3: 62
4: 566
953598349_953598357 -9 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598357 3:44338547-44338569 GGGAGGGTGTTGGGGGCAGGTGG 0: 1
1: 3
2: 21
3: 257
4: 2193
953598349_953598361 2 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598361 3:44338558-44338580 GGGGGCAGGTGGAGCCGGGAGGG 0: 1
1: 0
2: 8
3: 97
4: 1180
953598349_953598364 21 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598364 3:44338577-44338599 AGGGCCCAGCTGAGAATTCAGGG 0: 1
1: 1
2: 3
3: 11
4: 217
953598349_953598366 25 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598366 3:44338581-44338603 CCCAGCTGAGAATTCAGGGTTGG 0: 1
1: 0
2: 0
3: 24
4: 194
953598349_953598363 20 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598363 3:44338576-44338598 GAGGGCCCAGCTGAGAATTCAGG 0: 1
1: 1
2: 1
3: 19
4: 219
953598349_953598360 1 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598360 3:44338557-44338579 TGGGGGCAGGTGGAGCCGGGAGG 0: 1
1: 1
2: 9
3: 107
4: 835
953598349_953598368 26 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598368 3:44338582-44338604 CCAGCTGAGAATTCAGGGTTGGG 0: 1
1: 0
2: 1
3: 15
4: 220
953598349_953598358 -3 Left 953598349 3:44338533-44338555 CCGCCGCCGGAGCGGGGAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 953598358 3:44338553-44338575 GTGTTGGGGGCAGGTGGAGCCGG 0: 1
1: 0
2: 8
3: 102
4: 813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953598349 Original CRISPR CACCCTCCCCGCTCCGGCGG CGG (reversed) Exonic
900188993 1:1345430-1345452 CACCCTCCCCCATCTGGCTGGGG - Intronic
900207901 1:1439424-1439446 CGCCCTCCCCGCCCCAGAGGAGG + Exonic
900415843 1:2534384-2534406 CCCCCTCCCCGCCCAGGCAGTGG + Intergenic
900645324 1:3706361-3706383 CCCCCTCCCCGGGCCTGCGGCGG - Intronic
900645341 1:3706406-3706428 CCCCCTCCCCGGGCCTGCGGCGG - Intronic
901332688 1:8423514-8423536 ACCCCTCCCCGCCCCGGTGGGGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
904642007 1:31938131-31938153 CACCCGGCCCGGCCCGGCGGCGG + Exonic
904938319 1:34147521-34147543 CACCCTCCTCACTCCGGGGGAGG - Intronic
908131837 1:61082368-61082390 CCCCCTCCCCCCCGCGGCGGCGG + Intronic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
914005626 1:143729889-143729911 CCCCCTGCCGGCTCCGGCAGCGG - Intergenic
914098092 1:144561135-144561157 CCCCCTGCCGGCTCCGGCAGCGG - Intergenic
914300890 1:146376480-146376502 CCCCCTGCCGGCTCCGGCAGCGG + Intergenic
915953604 1:160205837-160205859 CTCCCTCCCCGCTCAGGCTTCGG + Intronic
920021280 1:202958280-202958302 CGCCCTCCCCGCGCCGGAAGGGG + Exonic
922526705 1:226309413-226309435 CTCCCCCCGCGCTCCGGCGCCGG - Exonic
924179150 1:241424069-241424091 CACCCTCCCTGCAGCGGCGGCGG - Intergenic
1062800548 10:376294-376316 CTCCCTGCCGGCTCCGTCGGGGG - Intronic
1065100367 10:22325575-22325597 CACCCACCCCGCCCCCGCGCCGG + Intronic
1067697363 10:48545591-48545613 CATCCTCCCCACTCAGGCGGCGG + Intronic
1068866865 10:61903499-61903521 CTCCCTCCCCGCTGCGCCGTGGG - Intronic
1070800842 10:79243571-79243593 CCCGCTCCGCGCCCCGGCGGCGG - Intronic
1071579685 10:86757245-86757267 CAGCCTCGCCGCTCCGGGGCGGG - Intronic
1075297707 10:121292628-121292650 CTCTCTCCCCTCCCCGGCGGTGG + Intergenic
1076566111 10:131400635-131400657 CACCCTCCCCACTCAGGTTGGGG - Intergenic
1076683826 10:132187836-132187858 AAGCCTCCCCGCTCGGGCGGGGG + Intronic
1076902760 10:133347917-133347939 CCCTCTCCCCGCTCCTGTGGAGG + Intronic
1081580504 11:44348545-44348567 CACCCTCCCCGTTCCAGATGGGG - Intergenic
1082807761 11:57461139-57461161 CTCCCTCCCCGCTCCGGGCCGGG - Intronic
1083418392 11:62539804-62539826 CACCCTGCCTGCTCTGGCTGTGG + Intronic
1083625608 11:64070575-64070597 CACCCTCCCCTCTCCCCCGGAGG + Intronic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1085561265 11:77474203-77474225 CCCCCTCCCCGGCGCGGCGGCGG + Intronic
1087755115 11:102047328-102047350 CTCCCTCCCTGCACCCGCGGCGG + Intergenic
1088172825 11:107017819-107017841 CACCCTCCTGGCCCCGGCAGTGG + Exonic
1090352169 11:126114629-126114651 CACCATCCTGGCTCCGGGGGAGG + Intergenic
1090780390 11:130002221-130002243 CGGCCTGCGCGCTCCGGCGGCGG - Intronic
1096680446 12:53252190-53252212 CACCCTCCCCGCTGTGGCTCCGG - Intronic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1102525885 12:113512184-113512206 CACCCTTCCCGCTCAGATGGGGG + Intergenic
1103534765 12:121626832-121626854 CCCCGTCCCCGCTGCGGCGGCGG - Exonic
1104093280 12:125533665-125533687 CGCCCTCCCCTCCCCGGCGGAGG + Intronic
1104787162 12:131457172-131457194 CACCCACCCCGCTCCAGCCCAGG + Intergenic
1105699577 13:22926355-22926377 CACCCGCCCCGCCCCGGCCCAGG - Intergenic
1106602557 13:31200219-31200241 CTCCCTCCCCGCGCCGACCGGGG - Intronic
1108643648 13:52406189-52406211 CGCCCTCCCCACGCCGTCGGGGG - Intronic
1108787420 13:53921549-53921571 CACCCTCCCTGCAGCGGCAGCGG + Intergenic
1116426627 14:44798972-44798994 CCACCTCCCCGCTCCTGCGCCGG + Intergenic
1121030802 14:90657137-90657159 CCCCCTCCCCGCTCCTGCAGAGG - Intronic
1121103357 14:91264716-91264738 CACCCTCCCCAGGCCGGTGGGGG - Intergenic
1121732329 14:96195222-96195244 CCCCCTCCCTGCTCCGTGGGTGG - Intergenic
1127867219 15:63042593-63042615 CCCCCTCCCCGCTCCTCCCGCGG - Intergenic
1130966986 15:88705183-88705205 CAGCCTCCCCGCCCCTGCTGTGG - Intergenic
1132819925 16:1859904-1859926 CTCCCTCCCGGCTCCTGCTGAGG + Intronic
1134121134 16:11586139-11586161 CACCTACCCAGCACCGGCGGTGG + Intronic
1142234364 16:88914962-88914984 CCCCCACCCCGCCCCGGCAGCGG - Intronic
1142590600 17:1003942-1003964 GACCCTCCCCACTCTGGGGGTGG + Exonic
1146061854 17:29612013-29612035 CACCTTCCCAGCACCGGCAGGGG - Intronic
1146249046 17:31321792-31321814 AACCCTCCCTGCTCTGGAGGCGG - Intronic
1146284802 17:31567135-31567157 CCCCCTCCCCGCTCCGGCTCTGG - Intergenic
1147360287 17:39925961-39925983 CGCCCTCCCCTCTCAGGTGGAGG - Exonic
1147382247 17:40062862-40062884 CCCCCGCCCCGCTCCGGCTGGGG - Exonic
1148386586 17:47238620-47238642 CACCCTCCCCGCAGCCGCGGTGG + Intergenic
1148826464 17:50397625-50397647 CAACCCCACCCCTCCGGCGGCGG - Intergenic
1150653875 17:67027097-67027119 CACCATCCCTGCTCCTGCGGAGG + Intronic
1151652136 17:75476620-75476642 CACCCTCCCCGCTTTGAGGGAGG + Intronic
1151854497 17:76711070-76711092 CACCCTCCCGGGGCCGGAGGGGG - Intergenic
1152245706 17:79183556-79183578 CAGCCTCCCCGCCCGGGCAGGGG - Intronic
1152297426 17:79476155-79476177 CTCCCTTCCCGCTCCAGCGCTGG + Intronic
1152417862 17:80174749-80174771 CCCCCTCCCCACTCCTGCTGAGG + Intronic
1152525655 17:80886982-80887004 CACCCTTCCCGCTCCGATGCAGG - Intronic
1152728674 17:81959749-81959771 CGCGCGCCCAGCTCCGGCGGAGG + Intronic
1156495851 18:37524802-37524824 CGCCCTCCGCGCCCCGGCCGCGG + Intronic
1159586638 18:70288939-70288961 CCCGCTCCCCGCTCGGGCCGAGG + Exonic
1160859106 19:1230207-1230229 CACCCTCCCTGATCCAGAGGCGG - Exonic
1160960607 19:1719050-1719072 CCCCAGCCCCGCTGCGGCGGCGG - Intergenic
1161065711 19:2236290-2236312 CGCCGTCCCCGCTCAGGCTGGGG + Exonic
1161203772 19:3029546-3029568 CCCCCCCCCCGCTCCCACGGTGG - Intronic
1161702367 19:5802514-5802536 CCCCCTCCCCGCCGCGGCTGGGG - Intergenic
1162803226 19:13122516-13122538 CACCCCCCCCCCCCCGGCAGGGG - Intronic
1162925971 19:13930662-13930684 CACCCTCCCTGCTCCGGGGCGGG - Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163403310 19:17107609-17107631 CTCCCTCCCGGCTCTGGGGGAGG + Intronic
1166046322 19:40233015-40233037 CACCCTCTCCTCTGCGGGGGTGG - Exonic
1166304093 19:41928000-41928022 CCCCCTCCCCGCCCCTGCGCCGG + Intronic
1166317579 19:41997709-41997731 CGCCCTCCCTGCCCCGCCGGAGG - Intergenic
1167594252 19:50418875-50418897 CACCCTCCTCCCCCCGGCAGGGG + Intronic
1168169567 19:54576550-54576572 CACCCTCCCCGCTGCTGCCCTGG - Intronic
925140529 2:1547096-1547118 CTCCCTCCCCGCTCCACCAGGGG - Intergenic
925590927 2:5508125-5508147 CACCTGCCCTGCTCCGGAGGTGG + Intergenic
925730636 2:6917664-6917686 CGCCCTCCCCGCTCCGCGGCCGG - Intronic
932178308 2:69622312-69622334 CCCCCTCCCCCGCCCGGCGGTGG + Intronic
932728415 2:74199253-74199275 CGCCCTCCTCCCTCCGCCGGTGG + Intronic
934736236 2:96691269-96691291 CACGCGCCCAGCGCCGGCGGCGG - Intergenic
936068410 2:109349406-109349428 CTCCCTCCCCACTCAGTCGGAGG + Intronic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
940987202 2:160062056-160062078 CACCCTCCTGGCTCCTGCGGGGG - Intronic
942241108 2:173964674-173964696 CACCCGCCCCCCGGCGGCGGCGG + Intronic
948912281 2:241010651-241010673 CACCCTCCTCTCTCAGGCTGTGG - Intronic
948953795 2:241272311-241272333 CCCCTCCCCCGCTCCGGCGGGGG - Intronic
1171567740 20:26209573-26209595 CACCCCCACCGCTGCGGAGGGGG + Intergenic
1174584241 20:51595180-51595202 CCCCCTAGCGGCTCCGGCGGAGG + Intergenic
1175997266 20:62817381-62817403 CCCCCGCCTCCCTCCGGCGGCGG - Intronic
1178513830 21:33229897-33229919 CCCCGCCCCCGCGCCGGCGGCGG + Intronic
1179947680 21:44689019-44689041 CAACCTCCCCACTCAGGTGGGGG + Intronic
1179987686 21:44930567-44930589 TGCCCTCCCCGCCCCTGCGGTGG - Intronic
1180708287 22:17822915-17822937 CGCCCTCCCCGCCCCTGTGGTGG - Intronic
1180991871 22:19941847-19941869 GACCCGCCCCGGTCCGGCGCAGG - Exonic
1184091336 22:42294528-42294550 CTCCCTCCCAGCTCCGGGAGAGG + Intronic
1184465712 22:44668271-44668293 CTCCCTCCCCGCTCCGCCCGCGG + Intergenic
1185278485 22:49960108-49960130 CAGCCTCGCAGCCCCGGCGGGGG - Intergenic
1185375577 22:50481463-50481485 CCCCCTCCCCGCCCCGAGGGTGG + Intergenic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
951968948 3:28421354-28421376 CACCCTTCCTGCTCAGGTGGTGG - Intronic
953598349 3:44338533-44338555 CACCCTCCCCGCTCCGGCGGCGG - Exonic
954202099 3:49029497-49029519 TACCCGCCTCGCTGCGGCGGGGG + Intergenic
954364986 3:50140845-50140867 CACCCGCCCTGGTCCTGCGGAGG + Intergenic
954706026 3:52480935-52480957 CACCCTCCCCTCTTCCGTGGGGG - Intronic
954779068 3:53046014-53046036 CTCCACCCGCGCTCCGGCGGAGG + Exonic
955326584 3:58013314-58013336 CACCCTGCCTGCTCTGGCGCTGG - Intronic
956678002 3:71753613-71753635 CGCGCTGCGCGCTCCGGCGGAGG + Intronic
960847980 3:122022193-122022215 CTCCCTCCCCGCTGCGCCGAGGG - Exonic
960937618 3:122913141-122913163 CGCCCTCACCGCTCCGGGGCTGG + Intronic
961663735 3:128483953-128483975 CAGCCACCCCTCTCTGGCGGCGG - Exonic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968611521 4:1559309-1559331 CAACCTCCCCGCACCGTGGGAGG + Intergenic
969671515 4:8592727-8592749 CGCCCTCCCTGCGCCGGGGGCGG + Exonic
984639294 4:182144612-182144634 CCCGCTCCCCGCTCCCTCGGCGG + Intronic
985610775 5:886923-886945 CACCTGCCGCGCTCTGGCGGTGG - Intronic
985748167 5:1659540-1659562 CACCCTCCCTGCCCCGGGAGAGG - Intergenic
987340608 5:16936145-16936167 CTCCCTCTGCGCTCCGGCCGGGG + Exonic
990382919 5:55233467-55233489 CCGCCTCCCCGCTCGGGCGGCGG + Exonic
997223963 5:132194977-132194999 CACCTTCCCCGCTCCGCAAGAGG + Exonic
1000305021 5:159987072-159987094 CACCCTGCCCCCAGCGGCGGGGG + Intergenic
1002023925 5:176384066-176384088 CACACTCCCCGCTCTGGGGAAGG - Exonic
1002182121 5:177436062-177436084 CGCCCGCCCAGCTCCGGAGGTGG + Exonic
1002600528 5:180352128-180352150 CACGCTGCCCGCTCCGCCGTAGG + Intronic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1008109566 6:47477930-47477952 CACCCTGGCCGCTCCCGCAGTGG - Exonic
1013793436 6:113859539-113859561 CTCCCTCCCCACAACGGCGGGGG + Intronic
1014755879 6:125301762-125301784 CGGCCTCCCCGCTCGGCCGGCGG - Intronic
1015541428 6:134317827-134317849 CTCGCTCCCCGCGCCGGCCGCGG - Exonic
1019711284 7:2519404-2519426 CACCCTGCCCGCTGCGCCGAGGG + Intronic
1021760632 7:23900236-23900258 CACCCTCCCAGCTCAGGCAAGGG - Intergenic
1022112385 7:27239638-27239660 CACCCACCCCCCTCCGGCCCGGG + Intergenic
1023986500 7:45100206-45100228 CACCCTCCCCACTCTGGCCAAGG + Exonic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1027151991 7:75739387-75739409 TACCCTGCCCGCTCCTGCAGGGG + Intergenic
1029640423 7:101816441-101816463 CCCCCTCCCCGGTCCCGCGGCGG - Intronic
1034338945 7:150340400-150340422 GACCCTCCCCGCTCCTGCCCGGG + Intronic
1034911600 7:155002761-155002783 CCCCGTCCCCGCTCCTGCCGCGG - Intronic
1035024074 7:155815139-155815161 CCCCCTCCCCGCACCAGCAGAGG + Intergenic
1036827137 8:11986320-11986342 CACCCTCCCCGCCCCGGCCCTGG - Intergenic
1038516042 8:28188461-28188483 CACCCTCCCTCCTCCGGGGAGGG + Intronic
1039996859 8:42541686-42541708 CACGCTGCCGGCTCCGGAGGCGG - Intronic
1049936315 9:504598-504620 CGGCTTCCCCGCCCCGGCGGCGG + Intronic
1053001273 9:34578402-34578424 GACCCTCCCCGCTCCGGTCCCGG + Intronic
1057489150 9:95508375-95508397 CTCCGTCCCCGCGGCGGCGGCGG - Exonic
1059375269 9:113876245-113876267 CGCCCGCCCCGCTCAGGCCGGGG - Intergenic
1061365785 9:130172093-130172115 GGCCCTCCCCGCCGCGGCGGGGG + Intergenic
1062216850 9:135393932-135393954 CACCGTCCCTGCTCCCTCGGAGG + Intergenic
1062389229 9:136327466-136327488 CCCCCTCCCCGCGCGGGCGGCGG + Exonic
1062440947 9:136568983-136569005 CACCCTCCCAGTCCCGGCTGAGG - Intergenic
1203788396 EBV:140812-140834 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788440 EBV:140914-140936 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788484 EBV:141016-141038 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788528 EBV:141118-141140 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788572 EBV:141220-141242 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788616 EBV:141322-141344 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788660 EBV:141424-141446 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788704 EBV:141526-141548 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788748 EBV:141628-141650 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788792 EBV:141730-141752 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788836 EBV:141832-141854 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788880 EBV:141934-141956 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788924 EBV:142036-142058 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788968 EBV:142138-142160 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789012 EBV:142240-142262 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789056 EBV:142342-142364 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789100 EBV:142444-142466 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789144 EBV:142546-142568 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789188 EBV:142648-142670 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789232 EBV:142750-142772 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789276 EBV:142852-142874 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789320 EBV:142954-142976 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789364 EBV:143056-143078 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789408 EBV:143158-143180 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1185506551 X:635507-635529 CCCCCTCCTCCCTCCGGCTGTGG + Intronic
1199413108 X:147548382-147548404 CCCCCTCCCCCCACCGGGGGGGG - Intergenic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic