ID: 953599406

View in Genome Browser
Species Human (GRCh38)
Location 3:44348342-44348364
Sequence GGAGCTGTTCCCAGAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 11, 3: 64, 4: 973}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953599406_953599413 9 Left 953599406 3:44348342-44348364 CCAGGGGCTCTGGGAACAGCTCC 0: 1
1: 0
2: 11
3: 64
4: 973
Right 953599413 3:44348374-44348396 TGGACAGTCCGATTTCCAGTGGG 0: 64
1: 206
2: 400
3: 237
4: 139
953599406_953599417 24 Left 953599406 3:44348342-44348364 CCAGGGGCTCTGGGAACAGCTCC 0: 1
1: 0
2: 11
3: 64
4: 973
Right 953599417 3:44348389-44348411 CCAGTGGGGTCCCACACAGATGG 0: 73
1: 380
2: 289
3: 182
4: 271
953599406_953599412 8 Left 953599406 3:44348342-44348364 CCAGGGGCTCTGGGAACAGCTCC 0: 1
1: 0
2: 11
3: 64
4: 973
Right 953599412 3:44348373-44348395 TTGGACAGTCCGATTTCCAGTGG 0: 67
1: 202
2: 381
3: 273
4: 138
953599406_953599414 10 Left 953599406 3:44348342-44348364 CCAGGGGCTCTGGGAACAGCTCC 0: 1
1: 0
2: 11
3: 64
4: 973
Right 953599414 3:44348375-44348397 GGACAGTCCGATTTCCAGTGGGG 0: 62
1: 200
2: 376
3: 242
4: 162
953599406_953599418 25 Left 953599406 3:44348342-44348364 CCAGGGGCTCTGGGAACAGCTCC 0: 1
1: 0
2: 11
3: 64
4: 973
Right 953599418 3:44348390-44348412 CAGTGGGGTCCCACACAGATGGG 0: 268
1: 290
2: 266
3: 132
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953599406 Original CRISPR GGAGCTGTTCCCAGAGCCCC TGG (reversed) Intronic
900157886 1:1210864-1210886 GCAGCTGGCCCCTGAGCCCCGGG - Intergenic
900350712 1:2233241-2233263 GGTCCTGTTCCCAGAGGTCCGGG + Intronic
900440552 1:2652951-2652973 GGAGCAGTGCCCACACCCCCAGG + Intronic
900440720 1:2653794-2653816 GGAGCAGTGCCCACACCCCCAGG + Intronic
900440758 1:2653994-2654016 GGAGCAGTGCCCACACCCCCAGG + Intronic
900441126 1:2655879-2655901 GGAGCAGTGCCCAAACCCCCAGG + Intronic
900441588 1:2658288-2658310 GGAGCAGTGCCCACACCCCCAGG + Intronic
900442058 1:2660695-2660717 GGAGCAGTGCCCACACCCCCAGG + Intronic
900442951 1:2665311-2665333 GGAGCAGTGCCCACACCCCCAGG + Intronic
900443844 1:2669927-2669949 GGAGCAGTGCCCACACCCCCAGG + Intronic
900444375 1:2672698-2672720 GGAGCAGTGCCCACACCCCCAGG + Intronic
900444846 1:2675105-2675127 GGAGCAGTGCCCACACCCCCAGG + Intronic
900445277 1:2677354-2677376 GGAGCAGTGCCCACACCCCCAGG + Intronic
900445456 1:2678317-2678339 GGAGCAGTGCCCACACCCCCAGG + Intronic
900446263 1:2682533-2682555 GGAGCAGTGCCCACACCCCCAGG + Intronic
900446839 1:2685463-2685485 GGAGCAGTGCCCACACCCCCAGG + Intronic
900446992 1:2686225-2686247 GGAGCAGTGCCCACACCCCCAGG + Intronic
900447669 1:2689520-2689542 GGAGCAGTGCCCAGAGCCCCAGG + Intronic
900447845 1:2690404-2690426 GGAGCAGAACCCAGAACCCCAGG + Intronic
900448342 1:2692930-2692952 GGAGCAGTGCCCACACCCCCAGG + Intronic
900448486 1:2693651-2693673 GGAGCAGTGCCCACACCCCCAGG + Intronic
900449593 1:2699115-2699137 GGAGCAGTGCCCACACCCCCAGG + Intronic
900450068 1:2701525-2701547 GGAGCTGCACCCATACCCCCAGG + Intronic
900450521 1:2747300-2747322 GGAGCAGTGCCCAGAGCCCCAGG + Intronic
900450696 1:2748184-2748206 GGAGCAGAACCCAGAACCCCAGG + Intronic
900451815 1:2753882-2753904 GGAGCAGTGCCCACACCCCCAGG + Intronic
900451959 1:2754603-2754625 GGAGCAGTGCCCACACCCCCAGG + Intronic
900453058 1:2760066-2760088 GGAGCAGTGCCCACACCCCCAGG + Intronic
900453555 1:2762636-2762658 GGAGCTGCACCCATACCCCCAGG + Intronic
900453887 1:2764366-2764388 GGAGCAGTGCCCACACCCCCGGG + Intronic
900453907 1:2764446-2764468 GGGGCAGTGCCCACAGCCCCAGG + Intronic
900454268 1:2766221-2766243 GGAGCTGCACCCATACCCCCAGG + Intronic
900454997 1:2769897-2769919 GGAGCTGCACCCATACCCCCAGG + Intronic
900455333 1:2771628-2771650 GGAGCAGTGCCCACACCCCCGGG + Intronic
900455353 1:2771708-2771730 GGGGCAGTGCCCACAGCCCCAGG + Intronic
900455747 1:2773643-2773665 GGAGCTGCACCCATACCCCCAGG + Intronic
900456090 1:2775456-2775478 GGAGCAGTACCCACACCCCCAGG + Intronic
900590518 1:3457460-3457482 GCAGCTGTGCCCAGAGCCCAAGG + Intronic
900840821 1:5047236-5047258 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
900847510 1:5115511-5115533 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
901463753 1:9407361-9407383 GGAGCTGGTCCAGGAACCCCAGG - Intergenic
902050951 1:13563269-13563291 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
902213514 1:14920593-14920615 GGAGACCTTCCCAGACCCCCTGG - Intronic
902518884 1:17004796-17004818 GGAGCCGTCCCCACAGTCCCAGG - Exonic
902683572 1:18060795-18060817 GGCTCTGTTCCCAGGCCCCCCGG + Intergenic
903663655 1:24994073-24994095 GCAGCAGGTCCCAGAGCCCCAGG - Intergenic
903833651 1:26189371-26189393 GGAGCTGTACTCAGAGGGCCTGG + Exonic
904393989 1:30205781-30205803 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
904499286 1:30904995-30905017 GTGTCTGTCCCCAGAGCCCCTGG + Intronic
904711667 1:32434736-32434758 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
904996450 1:34635279-34635301 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
905019552 1:34799206-34799228 GGCTCTGATCCCAGAGCCACAGG + Intronic
905395652 1:37664878-37664900 GTTGGTGTTCCCAGAGCCCCTGG + Intergenic
905429320 1:37910040-37910062 GCAGCCACTCCCAGAGCCCCTGG + Intronic
906080952 1:43087897-43087919 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
906744489 1:48212300-48212322 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
907503536 1:54901182-54901204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
907521291 1:55024989-55025011 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
908460425 1:64343721-64343743 GCAGCTTTTCCCAGAGCCCCAGG + Intergenic
908461683 1:64353289-64353311 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
908591923 1:65645197-65645219 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
908852437 1:68388654-68388676 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
909014741 1:70369784-70369806 GCAGCCACTCCCAGAGCCCCTGG + Intronic
909550990 1:76898095-76898117 GCAGCCACTCCCAGAGCCCCTGG - Intronic
909608901 1:77532767-77532789 GAGGCTGGTGCCAGAGCCCCAGG + Intronic
909776658 1:79491884-79491906 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
909909992 1:81247828-81247850 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
909978420 1:82070837-82070859 GCAGCCATTCCCAGAGCCCCTGG - Intergenic
911147956 1:94570180-94570202 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
911510589 1:98804561-98804583 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
911759750 1:101601356-101601378 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
912296503 1:108475340-108475362 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
912813599 1:112811828-112811850 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
913229483 1:116729885-116729907 TGGGCTGTTCCCTGAGCCCATGG + Intergenic
913245160 1:116864487-116864509 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
914827586 1:151146639-151146661 GGGGCCGAGCCCAGAGCCCCGGG - Intronic
915564268 1:156705210-156705232 GGCGTCGTGCCCAGAGCCCCGGG + Intronic
915596967 1:156901527-156901549 GGATCTGTTCACAGAGCCTATGG - Intronic
915604823 1:156943886-156943908 GGACATGGTCCCTGAGCCCCAGG + Intronic
915638530 1:157203479-157203501 GGAGCTGAGACCAGAGCCCCAGG - Intergenic
915640022 1:157217536-157217558 GGAGCTGAGGCCAGAGACCCAGG - Intergenic
916328890 1:163593410-163593432 GCAGCCTCTCCCAGAGCCCCTGG + Intergenic
917749688 1:178042366-178042388 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
918118494 1:181517135-181517157 GAAGCTTTCCCCAGTGCCCCAGG - Intronic
918347150 1:183616036-183616058 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
918567639 1:185951621-185951643 GCAGCCACTCCCAGAGCCCCTGG - Intronic
918711750 1:187739364-187739386 GGAGCAGTTCAGAGAGCTCCAGG - Intergenic
918714372 1:187768818-187768840 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
919476429 1:198037182-198037204 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
919782229 1:201228485-201228507 GAGGCTGTGCCCAGAGCCCCAGG + Exonic
919804887 1:201375694-201375716 GGAGCTCCTACCTGAGCCCCAGG + Intronic
919841233 1:201610925-201610947 GGAGGTGTTGGCAGAGCCCTGGG + Intergenic
920670986 1:208003450-208003472 GGAGGGGTCCCCAGAGGCCCTGG - Intergenic
920829433 1:209451324-209451346 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
921212452 1:212911894-212911916 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
921347609 1:214203172-214203194 CGAGCTGCTCCCAGGGTCCCAGG - Intergenic
921459749 1:215413265-215413287 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
921509290 1:216010395-216010417 GCAGCCACTCCCAGAGCCCCTGG + Intronic
921520163 1:216147936-216147958 GCAGCCACTCCCAGAGCCCCTGG + Intronic
921765658 1:218970470-218970492 GGGGCTGAGACCAGAGCCCCTGG - Intergenic
922049500 1:221976428-221976450 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
922363514 1:224843778-224843800 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
922482780 1:225950696-225950718 GGAGCTGGGAGCAGAGCCCCTGG + Intergenic
922599006 1:226835655-226835677 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
922857325 1:228786064-228786086 GGAGGAGTTCACAGAGGCCCTGG + Intergenic
922906428 1:229176808-229176830 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
923214165 1:231833532-231833554 GCAGCCACTCCCAGAGCCCCTGG - Intronic
923244788 1:232120567-232120589 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
923257241 1:232232526-232232548 GCAGCCACTCCCAGAGCCCCGGG - Intergenic
923408595 1:233686757-233686779 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
923770705 1:236935576-236935598 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
924099833 1:240591770-240591792 GGAGCTGTTTCAAAAGCTCCTGG - Intronic
924453703 1:244200968-244200990 GGACCTGGTCCCAGAATCCCCGG - Intergenic
1063527650 10:6800414-6800436 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1064886964 10:20122482-20122504 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1065437663 10:25718835-25718857 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1065943246 10:30583984-30584006 GGAGCTGTTCCCAGTCCCGGTGG + Intergenic
1066001267 10:31106028-31106050 AGAGCTGTTCCAAGATCCCACGG - Intergenic
1067360438 10:45573593-45573615 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1067451994 10:46387385-46387407 GGAGCTGTGCCCAGTGCCCCGGG + Intronic
1067585243 10:47472370-47472392 GGAGCTGTGCCCAGTGCCCCGGG - Intronic
1067655397 10:48187962-48187984 GGAGATGTTGCCACAGCCCCGGG + Intronic
1067793829 10:49306803-49306825 GGACCTGTGCCCAGATCCCAGGG + Intronic
1068058317 10:52037087-52037109 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1068179627 10:53502358-53502380 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1068231005 10:54169144-54169166 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1068545083 10:58335465-58335487 GGAGCCGCTCCCGGAGCCCCAGG + Intronic
1069431669 10:68341216-68341238 GGAGCTGATGGCAGAGCCACAGG + Exonic
1069821646 10:71232186-71232208 GGGGCTGTGCACAGAGCCACAGG - Intronic
1071187267 10:83059537-83059559 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1071485911 10:86102657-86102679 GGAGCAGTGCCAAGAGGCCCAGG + Intronic
1071550759 10:86564560-86564582 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1071600255 10:86955498-86955520 ACATCTGTTTCCAGAGCCCCAGG - Intronic
1071821768 10:89287084-89287106 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1071897703 10:90084363-90084385 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1071961142 10:90809814-90809836 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1072580293 10:96734601-96734623 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1072884553 10:99261978-99262000 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1073103490 10:101019168-101019190 GGAGCTGCTCTCAGAGGCCGGGG + Exonic
1073141193 10:101249157-101249179 GGAGATGTCCCCAGAGCCCAGGG - Intergenic
1073205615 10:101767888-101767910 GGAGCTGCGCCCAGAGCACTGGG - Intergenic
1073636109 10:105200502-105200524 GGACCTGTTCCCAGTGCTCTGGG - Intronic
1073709458 10:106020941-106020963 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1073933237 10:108600191-108600213 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1074019059 10:109564754-109564776 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1074711892 10:116184509-116184531 GGGGCTGTACCCAGGGCCGCAGG - Intronic
1074740811 10:116483042-116483064 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1075167986 10:120086368-120086390 TGAGCTATTCCCAGCTCCCCGGG + Intergenic
1075248730 10:120847237-120847259 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1075382753 10:122032293-122032315 GGAGGTGTTCCCAGTGATCCAGG - Intronic
1075846400 10:125548505-125548527 AGCCCTGTTCCCAGAGCCCTGGG + Intergenic
1076189871 10:128475420-128475442 GGAGATCATCCCAGAGACCCAGG - Intergenic
1076218927 10:128717662-128717684 GCCGCTGGTCCCAGAGGCCCAGG + Intergenic
1077211387 11:1372344-1372366 GGGGCTGATCCCAGAGGGCCCGG - Intergenic
1077222581 11:1424190-1424212 GGAACTGCTCCGTGAGCCCCGGG + Intronic
1077337906 11:2013684-2013706 GGTGCTGTCTCCAGAGCCCGAGG + Intergenic
1077392002 11:2304532-2304554 GGAGCTGTTTCCAAAGTCCCTGG + Intronic
1077544299 11:3162502-3162524 GGACATGATCCCAGAGGCCCTGG + Intronic
1077589850 11:3482957-3482979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1077612218 11:3650324-3650346 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1077850768 11:6073160-6073182 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1077883390 11:6368202-6368224 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1078509571 11:11975553-11975575 GGGGCTGTTCCCAGAACCCACGG + Intronic
1078789021 11:14524871-14524893 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1079230543 11:18645418-18645440 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1079447492 11:20570177-20570199 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1079672539 11:23187262-23187284 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1079763889 11:24365522-24365544 GGAGCTGTTCCCAAACCTCCGGG + Intergenic
1081356839 11:42122964-42122986 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1081537042 11:44003945-44003967 GGAGCTGTTCCCCCAGGCCTTGG + Intergenic
1081721785 11:45294679-45294701 GGAGCCGTGGCCAGAGCCCCTGG + Intergenic
1082197729 11:49324756-49324778 GCAGCTACACCCAGAGCCCCTGG - Intergenic
1083636246 11:64122511-64122533 GGAGGGTTTCCCAGATCCCCAGG - Intronic
1084047200 11:66576007-66576029 GAAGCCAGTCCCAGAGCCCCTGG + Intergenic
1084153534 11:67302137-67302159 GCAGCTGTCCACAGAGCCCAGGG + Exonic
1084191241 11:67499939-67499961 GGAGCTGTTCTCAGAGTCTCGGG + Exonic
1084232337 11:67762072-67762094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1084245567 11:67854731-67854753 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1084273487 11:68040743-68040765 GGGGCTGTCCCCTGAGGCCCGGG - Intronic
1084357766 11:68651292-68651314 GGAGCTGCTCTCAGGGGCCCTGG - Intergenic
1084526983 11:69703885-69703907 GGAGCTGCGCCGAGAGCCCCAGG - Exonic
1084536591 11:69760990-69761012 GGAGCAGTTCCCTGGGCCCCAGG - Intergenic
1084624875 11:70298683-70298705 GAAGCTCTTCCCCGAGCCCAGGG - Intronic
1084827121 11:71739847-71739869 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1084836774 11:71807569-71807591 TGAGCTGTGGCCAGAGCCCAAGG - Intergenic
1085229036 11:74949008-74949030 GGAGCGGCTCCGAGATCCCCGGG - Exonic
1085570226 11:77552321-77552343 GCAGCCATTCCTAGAGCCCCTGG + Intronic
1085934298 11:81124212-81124234 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1086005051 11:82027609-82027631 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1086133182 11:83421512-83421534 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
1086134801 11:83434907-83434929 GCAGCCGCTTCCAGAGCCCCTGG - Intergenic
1086136238 11:83446224-83446246 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1086550247 11:88045580-88045602 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1086658090 11:89383371-89383393 GCAGCTACTCCCAGAGCCCCTGG + Intronic
1087099673 11:94352041-94352063 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1087314708 11:96590312-96590334 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1087839509 11:102907402-102907424 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1088554992 11:111052581-111052603 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1089349125 11:117811670-117811692 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1089597481 11:119590128-119590150 GAAGCTGTTTTCAGAGCCCTAGG + Intergenic
1089664907 11:120012313-120012335 GGGGATCTTCCCAGACCCCCCGG + Intergenic
1090107565 11:123868921-123868943 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1090818232 11:130316641-130316663 GGAGCTGCCACCACAGCCCCTGG - Intergenic
1090850564 11:130567687-130567709 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
1090955614 11:131510869-131510891 GGAGCTCTTCCCACGGCCCAGGG - Intronic
1202820890 11_KI270721v1_random:68866-68888 GGTGCTGTCTCCAGAGCCCGAGG + Intergenic
1091393926 12:142174-142196 AGAGCTCTTCCCAGGGCCTCCGG - Intronic
1091780899 12:3214019-3214041 GGAGTTGATCCCAGAGACCTGGG + Intronic
1091886553 12:4020919-4020941 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1092402465 12:8188537-8188559 TGAGCTGTGGCCAGAGCCCAAGG + Intronic
1092416144 12:8291862-8291884 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092474515 12:8807325-8807347 GCAGCCGCTCCCAGAGCCCCTGG + Intergenic
1092626718 12:10336252-10336274 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092723689 12:11465493-11465515 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1092739292 12:11613018-11613040 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1092789739 12:12060781-12060803 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1092924825 12:13263297-13263319 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093024365 12:14232968-14232990 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093071132 12:14708197-14708219 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093267977 12:17025027-17025049 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093302264 12:17471938-17471960 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093321954 12:17723598-17723620 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1093358468 12:18197339-18197361 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1093578848 12:20765765-20765787 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1093584486 12:20820325-20820347 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1094109159 12:26842878-26842900 AGAGCTGTCTCCAGAGCCTCTGG + Intergenic
1096907161 12:54946251-54946273 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1097197140 12:57249233-57249255 GGAACTTCCCCCAGAGCCCCAGG - Exonic
1097303410 12:58042897-58042919 GGACCTAGTCCCAGACCCCCAGG - Intergenic
1097398619 12:59104228-59104250 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1097542168 12:60955306-60955328 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1097777960 12:63669306-63669328 GGGTCTGATCCCAGAGCCTCAGG + Intergenic
1098173610 12:67769972-67769994 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1098402282 12:70087789-70087811 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1098460934 12:70732398-70732420 GGAGCTCCCCTCAGAGCCCCAGG + Intronic
1098919938 12:76293848-76293870 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1099292069 12:80786401-80786423 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1099687988 12:85913725-85913747 GAGGCTGTTCCCCAAGCCCCAGG + Intergenic
1099762617 12:86941188-86941210 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1100561391 12:95751565-95751587 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1100940330 12:99717576-99717598 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1102346823 12:112166127-112166149 TGTGCTGCACCCAGAGCCCCAGG + Intronic
1102514400 12:113436697-113436719 CCAGCTCTTCCCTGAGCCCCTGG + Intronic
1103715027 12:122940213-122940235 GGAGCTCTTCCCACTGCCCGAGG + Exonic
1103956867 12:124582273-124582295 GGAGCTGTACCCAGGGCCTGGGG - Intergenic
1104017241 12:124969277-124969299 GCAGCTCTTCCCTGAGCCCCCGG - Intronic
1104181494 12:126386125-126386147 GGAGCTGTTCCCACTGGCCTGGG - Intergenic
1104481434 12:129111287-129111309 GGATCCTTTCCCAGAGCCTCTGG + Intronic
1104842441 12:131831520-131831542 GCAGCTGCTCCCAGAGCTTCAGG + Intronic
1104949657 12:132433726-132433748 GGGTCTGCTCCCAGGGCCCCAGG + Intergenic
1105502328 13:20983404-20983426 GGAGGTCTTCCCTGAGCACCTGG - Exonic
1105638737 13:22240760-22240782 AGAGCTGCCCCCACAGCCCCTGG + Intergenic
1106802720 13:33272622-33272644 GCAGCTGCACCCAGAGGCCCAGG - Intronic
1106943473 13:34801032-34801054 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1107075613 13:36318831-36318853 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1107180206 13:37449655-37449677 GGAGCTGTTCCCATCGTCCTAGG - Intergenic
1107220267 13:37972499-37972521 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1107413586 13:40179883-40179905 TGAGCTGGTCACAGATCCCCAGG + Intergenic
1107683110 13:42870741-42870763 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108513026 13:51172256-51172278 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108698670 13:52925434-52925456 GGAGCTGTGCCCAGCGTCACAGG + Intergenic
1108803843 13:54131014-54131036 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108814156 13:54269245-54269267 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108913388 13:55581568-55581590 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1108947465 13:56042700-56042722 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1108952917 13:56115741-56115763 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1109499323 13:63215512-63215534 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1109716711 13:66229704-66229726 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1110765511 13:79276524-79276546 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1110978521 13:81868563-81868585 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1111126011 13:83911604-83911626 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1111302079 13:86360795-86360817 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1111362076 13:87189750-87189772 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1111396384 13:87673050-87673072 GCAGCTGTGCCCGGAGCCTCCGG + Intronic
1111458806 13:88516148-88516170 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1111631669 13:90851910-90851932 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1112066218 13:95795934-95795956 GGTCCTCTTCCCAGAGCCTCAGG + Intergenic
1112236863 13:97644705-97644727 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1112562563 13:100527046-100527068 CGAGCTGTTCCCAGTTCCCCGGG + Intronic
1112889286 13:104211380-104211402 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1114062062 14:19026933-19026955 GGAGCTGCTGCCAGCGCCACAGG - Intergenic
1114100197 14:19373064-19373086 GGAGCTGCTGCCAGCGCCACAGG + Intergenic
1114221711 14:20702972-20702994 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1114771022 14:25429003-25429025 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1115375042 14:32665365-32665387 GGAGCAGCTCACAGAGCTCCGGG + Intronic
1115514607 14:34173138-34173160 GAAGGTGTCCACAGAGCCCCGGG - Intronic
1115904840 14:38193180-38193202 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1116179711 14:41518332-41518354 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1116490550 14:45498707-45498729 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1116534751 14:46015727-46015749 GCAGCCATTCCCAGAGCCCCTGG - Intergenic
1116613545 14:47106570-47106592 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1116632932 14:47356954-47356976 GGAGCTCTTCCCACAGCTCGAGG - Intronic
1116703258 14:48265697-48265719 GCAGCCAGTCCCAGAGCCCCTGG - Intergenic
1116774945 14:49168163-49168185 GGAGCTGGTTCCAGAGGACCTGG + Intergenic
1116952945 14:50895560-50895582 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1117288228 14:54307860-54307882 GGAGTTGTTCCCACAGCCTTTGG - Intergenic
1117381231 14:55165617-55165639 GAATCTGTTCCAAGACCCCCAGG + Intronic
1117801213 14:59446445-59446467 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1117957884 14:61136745-61136767 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1118385882 14:65255238-65255260 GGAGCCCTTTCCAGAGCCCCAGG - Intergenic
1118777178 14:68980008-68980030 GGAGCGGTCCCCAGAGCCCGAGG - Intergenic
1119317235 14:73705880-73705902 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1119549701 14:75499580-75499602 AGAGCTGAGCCCTGAGCCCCGGG - Intergenic
1119783996 14:77298829-77298851 AGAGCTCTTCCCAGCGCTCCTGG - Intronic
1119872232 14:78027743-78027765 GGGGATTTTCCCAAAGCCCCTGG - Intergenic
1120438021 14:84503528-84503550 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1120991663 14:90382986-90383008 TGAGCTCTGCCCCGAGCCCCGGG + Intergenic
1121348869 14:93157011-93157033 GGAGCTGCTCCCAGGGTCTCTGG - Intergenic
1121703683 14:95975337-95975359 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1122041028 14:98987588-98987610 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1122363579 14:101181712-101181734 GGAGCTGTTTCCAGGGCCCATGG + Intergenic
1122630026 14:103103506-103103528 GGAGCGGTTCCCAGCCCCACCGG + Intronic
1122829843 14:104390454-104390476 CGACCTCTTCCCCGAGCCCCTGG - Intergenic
1123105987 14:105841285-105841307 GGAGCTCTGTGCAGAGCCCCGGG - Intergenic
1123494753 15:20814534-20814556 GGAGCTGCTGCCAGCGCCACAGG + Intergenic
1123551248 15:21383627-21383649 GGAGCTGCTGCCAGCGCCACAGG + Intergenic
1124200747 15:27676928-27676950 CCAGCTGTTCCCAGAGTCCTGGG + Intergenic
1124835417 15:33192297-33192319 GGAGCTGTTCCCAGAGGAAGAGG - Intronic
1125045808 15:35241159-35241181 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1125131485 15:36288964-36288986 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1125213185 15:37239518-37239540 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1126912375 15:53430155-53430177 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1128378153 15:67091973-67091995 GGTGGTGTTCCCAGAGCCCAGGG + Intronic
1128482899 15:68054796-68054818 GGCGCTCTTCTCAGACCCCCGGG + Intronic
1129259467 15:74356318-74356340 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1129364007 15:75043380-75043402 GAAACTGTTACCAGAGCCACAGG - Intronic
1129679812 15:77652331-77652353 GGGTCTGTTCCCAGAGTCCCCGG + Intronic
1130304582 15:82704641-82704663 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1130945914 15:88550824-88550846 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1131684212 15:94753163-94753185 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1131684737 15:94756861-94756883 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1131882484 15:96875147-96875169 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1132013083 15:98292922-98292944 GGAGCTGGGCCCGGAGCCCCGGG + Intergenic
1132263043 15:100442676-100442698 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1132340446 15:101074926-101074948 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1202959589 15_KI270727v1_random:110870-110892 GGAGCTGCTGCCAGCGCCACAGG + Intergenic
1132891554 16:2207261-2207283 GCAGCTGATCCCTGAGCCCGAGG + Exonic
1133078093 16:3295329-3295351 GGACCTGTGCCCAGACCCCTGGG + Intronic
1133651425 16:7817098-7817120 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1133859725 16:9583158-9583180 GGGTCTGACCCCAGAGCCCCAGG - Intergenic
1134093362 16:11403226-11403248 GGAGCCGTGCCCAGAGACACTGG + Intronic
1134297476 16:12959785-12959807 AGAGCTGTGCAAAGAGCCCCAGG - Intronic
1134465516 16:14473626-14473648 GGAGGTGTCCCAAGAGGCCCAGG + Intronic
1134569170 16:15276954-15276976 AGAGCTGTACCCCGAGCCTCTGG + Intergenic
1134934231 16:18232882-18232904 AGAGCTGTACCCCGAGCCTCTGG + Intergenic
1135025379 16:18995452-18995474 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1136472992 16:30494297-30494319 GCTGCTGTTCCAAGAGCCACAGG + Exonic
1138804980 16:60081222-60081244 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1139225883 16:65233155-65233177 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1139230567 16:65278572-65278594 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1139901698 16:70333327-70333349 GGAGCTGTTCTTGGAGTCCCTGG - Intronic
1139911344 16:70399300-70399322 GCAGCTGTTCCCAGCGCCAGAGG - Exonic
1139943019 16:70619787-70619809 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1139943687 16:70624104-70624126 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1140943551 16:79746659-79746681 GGTGATGTCCCCAGAGCCTCAGG + Intergenic
1141490334 16:84368388-84368410 GGCGCTGTCCCCAGAGCCCCTGG + Intergenic
1141565232 16:84897096-84897118 GGAGCTCTTCAGAGAGTCCCTGG + Intronic
1141625831 16:85260658-85260680 GGAGCTGTTCCCAGGGCAATGGG + Intergenic
1141703474 16:85652774-85652796 GGGGCAGGTCTCAGAGCCCCTGG + Intronic
1141714093 16:85716977-85716999 GGAGCAGATCCCAGGGACCCAGG + Intronic
1141896060 16:86959396-86959418 GGAGCTGCTGACAGAGCGCCTGG + Intergenic
1142107182 16:88310390-88310412 TGAGATGTGACCAGAGCCCCAGG - Intergenic
1142279827 16:89142041-89142063 GGTGCCATTCCCAGGGCCCCAGG - Intronic
1142599642 17:1047355-1047377 GGAGCTGTTCCCACGAACCCGGG - Intronic
1142694637 17:1627131-1627153 GGAGATGTCCTCAGAGCCCGTGG + Intronic
1142698876 17:1647935-1647957 GGAGCTGCTCACAGACCACCGGG - Exonic
1142715999 17:1747270-1747292 CAAGCTGTTCCCAGGGCTCCAGG - Intronic
1143273718 17:5694532-5694554 GGAGCAGTTTCCAGACTCCCAGG + Intergenic
1143340597 17:6207939-6207961 GGAGCCGTCCCCTGAGCTCCGGG + Intergenic
1143471421 17:7178230-7178252 CCAGCTGTTCCCACACCCCCGGG + Intronic
1143512688 17:7405053-7405075 GGAGCCGAGTCCAGAGCCCCGGG - Intronic
1144456531 17:15423380-15423402 GGAGCTTTGCCCTGATCCCCTGG - Intergenic
1144718930 17:17454380-17454402 GGAGTGGTACCCAGAGTCCCTGG + Intergenic
1144718951 17:17454481-17454503 GGAGCAGTACCCAGACTCCCTGG + Intergenic
1145214910 17:21043593-21043615 GGAGCTGTTTGCAGGGCCCCCGG + Intronic
1146167533 17:30601215-30601237 GCTGCTGCTCCCCGAGCCCCGGG - Intergenic
1146352986 17:32111483-32111505 GGGGCTGGTGCCAGAGCCCCAGG - Intergenic
1146597929 17:34185664-34185686 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1148456118 17:47812407-47812429 GGAGCTCCTCCAAGAGCACCAGG - Intronic
1148795076 17:50193001-50193023 CGAGGTGTTCCCGGACCCCCTGG - Exonic
1149319600 17:55470189-55470211 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1149564537 17:57631600-57631622 GGAGCTGTTCCCAGAGTGGTTGG - Intronic
1149608706 17:57943190-57943212 GGAGCCCTTCCCAAAGCCCCTGG + Intronic
1150007240 17:61477366-61477388 GGCGCGGCTGCCAGAGCCCCCGG - Intronic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150423958 17:65062236-65062258 GGAACTGTTCCTAGAGCCTTTGG - Intergenic
1150545500 17:66153499-66153521 GGACTTATACCCAGAGCCCCAGG - Intronic
1150605331 17:66685943-66685965 GGAGGTGTTGCCAGTGCCGCCGG + Intronic
1150643867 17:66966100-66966122 GGAGCTGTCCCCACGGTCCCGGG - Intronic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1151839722 17:76609274-76609296 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1151883069 17:76906260-76906282 GCAGGTGCTCCCACAGCCCCTGG - Intronic
1152146624 17:78572459-78572481 GGTGCAGGTGCCAGAGCCCCAGG + Intronic
1152240348 17:79157616-79157638 GGAGCTGTGCTCAGGGCCCAGGG - Intronic
1152410183 17:80119141-80119163 GGAGCTGCCCCCTGAGCGCCGGG + Intergenic
1152438265 17:80289105-80289127 GGGCCTGTTCCCAGAGCGGCAGG + Intronic
1152570858 17:81120692-81120714 GGGCCTGGTCCCAGAGCCTCCGG - Exonic
1152756337 17:82088606-82088628 TGGGCTGAACCCAGAGCCCCTGG - Intronic
1152848267 17:82615846-82615868 GGGGCTGGTGCCAGTGCCCCAGG - Exonic
1153023424 18:652687-652709 GGATATGTTCCAAGACCCCCAGG - Intronic
1153618750 18:6956644-6956666 CAAGCTCTTGCCAGAGCCCCGGG - Exonic
1154452156 18:14487055-14487077 GGAGCTGCTGCCAGCGCCACAGG + Intergenic
1155696985 18:28696420-28696442 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1155892666 18:31287555-31287577 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1157858515 18:51121668-51121690 GGAGGTGCTCCCTGAGCACCAGG - Intergenic
1157906360 18:51573358-51573380 GCAGCCGCTCCCAGAGCCCCTGG - Intergenic
1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG + Intergenic
1158336408 18:56417981-56418003 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1158576664 18:58644301-58644323 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1159164497 18:64684031-64684053 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1160222066 18:76984960-76984982 GGAGCTGCCACCAGGGCCCCGGG + Intronic
1160363858 18:78307844-78307866 GGAGCTGTTTCCAGATCTCTAGG - Intergenic
1160673131 19:375736-375758 GGAGGAGTTCCCGGAGACCCTGG - Exonic
1160790932 19:923439-923461 GGGGAGGTTCCCAAAGCCCCAGG + Intergenic
1160827995 19:1089667-1089689 GGAGCGGGTCCCACAGCCCAGGG - Intronic
1160879009 19:1311138-1311160 GGAGCAGTCCCCAGAGGTCCAGG + Intergenic
1160932224 19:1576272-1576294 GGAGCTGTGCCCCGGGACCCTGG - Intronic
1160986402 19:1840955-1840977 GGGGCAGGTCCCAGAACCCCGGG + Intronic
1161016464 19:1986047-1986069 GGCGCTGCTCCCAGAGCCGTGGG - Exonic
1161074867 19:2280722-2280744 GCTGCTGTTCCCAGAGGCCATGG + Intronic
1161109699 19:2462347-2462369 GCAGCTGCGCCCAGAGCCCGAGG + Intergenic
1161312839 19:3604339-3604361 GGCGCTGTTTCCAGAGGCCCGGG + Intronic
1161563153 19:4984851-4984873 GGAGCAGGTGCCAGACCCCCAGG - Intronic
1161608835 19:5229717-5229739 GGAGCCGTTACCAGGGCGCCCGG + Intronic
1161661752 19:5550861-5550883 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1161712073 19:5854500-5854522 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1161853380 19:6750452-6750474 GGGTCTGTTCCCAGGGTCCCAGG + Intronic
1161887061 19:7005224-7005246 GGAGCTGCTCCCCGATCACCCGG - Intergenic
1161888140 19:7012677-7012699 GGAGCTGCTCCCCGATCACCCGG + Intergenic
1163052330 19:14693711-14693733 GGAGCTCCGCTCAGAGCCCCAGG - Intronic
1163156093 19:15440609-15440631 GGGGGTGCTCCCAGGGCCCCCGG + Intronic
1163190504 19:15673476-15673498 GGAGCTCTTCCCTGGGCCTCAGG + Intronic
1163236844 19:16035001-16035023 GGAGCTCTTACCAGAGTCACGGG - Intergenic
1163641162 19:18462918-18462940 GTGGCTGTGCCCAGAGCCCTGGG + Intronic
1163678403 19:18666915-18666937 AGATCTGTCCCCAGAGCCACAGG + Intronic
1163907214 19:20157923-20157945 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1164153003 19:22570631-22570653 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1164459194 19:28433182-28433204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1164690647 19:30208525-30208547 TGAGCTGTCCCCAGCTCCCCGGG - Intergenic
1165496976 19:36158737-36158759 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1165510290 19:36262803-36262825 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1165708233 19:37991445-37991467 GTAGTTCTTCCCAGAGCACCAGG - Intronic
1165812002 19:38617498-38617520 GGAGGTGATCCCAGTGTCCCAGG + Intronic
1165835391 19:38752001-38752023 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1165861758 19:38912698-38912720 GGATCTCTTCCCAGAGCAGCAGG + Intergenic
1165904852 19:39187585-39187607 GGATCTGCTCCCCCAGCCCCAGG + Intergenic
1166733458 19:45071255-45071277 GGACCTGTCGCCAGAGGCCCTGG - Intergenic
1166905763 19:46107370-46107392 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1167046570 19:47053066-47053088 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1167710854 19:51109600-51109622 GGAGATGTGCAGAGAGCCCCAGG + Intergenic
1168051673 19:53834000-53834022 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1168227955 19:55010103-55010125 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1168372165 19:55844970-55844992 GGATCTCTTCCCAGAGCCGGAGG + Intronic
925828788 2:7875981-7876003 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
926094655 2:10073280-10073302 GGAGGTGTTTCCAAAGCCACAGG + Intronic
926118664 2:10229179-10229201 GGAGCTGAGCCCAAGGCCCCAGG + Intergenic
926224964 2:10961065-10961087 GGAGCTGCTGACTGAGCCCCGGG + Intergenic
926407798 2:12572147-12572169 GAAGCCACTCCCAGAGCCCCTGG + Intergenic
926413620 2:12628892-12628914 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
926464062 2:13167310-13167332 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
927134189 2:20084706-20084728 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
927960793 2:27239583-27239605 GGAGCTGTGCCCCCAACCCCTGG - Intronic
927962878 2:27251525-27251547 GGGTCTGACCCCAGAGCCCCAGG + Intergenic
928438042 2:31268612-31268634 GAAGATGTTCCCTAAGCCCCTGG + Exonic
928770210 2:34696243-34696265 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
928778334 2:34792098-34792120 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
928779673 2:34804286-34804308 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
928857203 2:35815471-35815493 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
929076643 2:38084085-38084107 GCAGCCACTCCCAGAGCCCCTGG - Intronic
929684494 2:44022363-44022385 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
930106327 2:47642777-47642799 GGAGCTATTTCCATAGCCCGGGG - Intergenic
930116535 2:47723073-47723095 GGAGCAGCTCCCAGATCCCAAGG - Intronic
930487331 2:52025433-52025455 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
930955129 2:57195357-57195379 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931026360 2:58116735-58116757 GCAGCCACTCCCAGAGCCCCTGG - Intronic
931236969 2:60420002-60420024 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931625810 2:64254919-64254941 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931850453 2:66246322-66246344 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
931906085 2:66845548-66845570 GGCTCTGTCCCCAGAGGCCCCGG - Intergenic
931948288 2:67333988-67334010 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
932159429 2:69446971-69446993 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
932174373 2:69586040-69586062 GGAGTTTTTCCCAGACCCCTTGG - Intronic
932854179 2:75217112-75217134 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
932973926 2:76577173-76577195 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
933013119 2:77090767-77090789 GCAGCCACTCCCAGAGCCCCTGG + Intronic
933079300 2:77967500-77967522 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
933179740 2:79215138-79215160 GCAGCCACTCCCAGAGCCCCTGG - Intronic
933329491 2:80877786-80877808 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
933552361 2:83792230-83792252 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
934710562 2:96511386-96511408 GGAGGTGATGCCAGGGCCCCGGG + Intergenic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
935735822 2:106105955-106105977 GGTGCTGTTCACAGAGCTGCTGG - Intronic
935961201 2:108427367-108427389 GGAGCTGTTCACAGAACTCAGGG - Intergenic
936623473 2:114123919-114123941 GCAGCTGCTCCCAAAGCCTCTGG - Intergenic
936794258 2:116187588-116187610 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
937296661 2:120813629-120813651 GCAGCTGGCCCCAGATCCCCAGG + Intronic
937377857 2:121349878-121349900 GGACCTGCTCCCTGAGCCCAAGG - Intronic
938100249 2:128493404-128493426 GGAGCGGGTCCCAGTGCCCAGGG + Intergenic
938238860 2:129727553-129727575 GGAGCTGTTCCCACAGGCCCAGG - Intergenic
938479429 2:131647114-131647136 GGAGCTGCTGCCAGCGCCACAGG - Intergenic
938777009 2:134550864-134550886 GGCTCTGCTCCCAGGGCCCCTGG + Intronic
939083109 2:137686263-137686285 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
940138419 2:150465179-150465201 GGAGCTGCTACCACAGACCCTGG - Intergenic
940318597 2:152350235-152350257 GGAGCAGTTTCCAGGGACCCTGG + Intronic
940508758 2:154586557-154586579 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
940530219 2:154869712-154869734 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
940726408 2:157341434-157341456 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
943412900 2:187563798-187563820 GCAGCCACTCCCAGAGCCCCTGG - Intronic
943421555 2:187673797-187673819 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
943806677 2:192132813-192132835 GCAGCCACTCCCAGAGCCCCTGG + Intronic
944251066 2:197580504-197580526 GCAGCCACTCCCAGAGCCCCTGG + Intronic
944394171 2:199249316-199249338 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
944876098 2:203965235-203965257 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
945102753 2:206276778-206276800 GAAGCTGTTGACAGAGCGCCTGG + Intronic
945554720 2:211263859-211263881 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
945858151 2:215091979-215092001 GCAGCCACTCCCAGAGCCCCTGG + Intronic
946215004 2:218177351-218177373 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
946309905 2:218877700-218877722 GGAATTGTTCCCCGAGCCCGTGG - Intergenic
946781013 2:223193160-223193182 GCAGCCACTCCCAGAGCCCCTGG - Intronic
946886529 2:224227681-224227703 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
946893305 2:224299066-224299088 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947793465 2:232880433-232880455 TGGGCTGTTCCCAAAGGCCCAGG - Intronic
947833320 2:233157332-233157354 GGAGCCTTTCCCAGAGCTTCTGG - Intronic
948062050 2:235049264-235049286 GGACCTGTGCCCAGTTCCCCTGG + Intronic
948256665 2:236573625-236573647 GGAGCTGGTCCCGGGGCCCCAGG + Intronic
948390717 2:237609346-237609368 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
948517107 2:238510991-238511013 CGAGCTGCTCCCGGAGCTCCTGG + Intergenic
948845961 2:240682944-240682966 TGTGGTGTTCCCAGAGGCCCAGG - Intergenic
948847896 2:240691785-240691807 TGTGGTGTTCCCAGAGGCCCAGG + Intergenic
949076011 2:242058343-242058365 GCAGCTGTTCCCAGAGCAGTGGG - Intergenic
1168800223 20:639989-640011 GCTGCTGTCACCAGAGCCCCAGG - Intergenic
1168930374 20:1618691-1618713 GGAGCTGACCCCAGAACCACAGG - Intronic
1168943250 20:1731062-1731084 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1169171096 20:3466174-3466196 TGAGCTGTTGGCAGAGCTCCTGG - Intergenic
1169934071 20:10864476-10864498 GGAGCTCTTCACAGCTCCCCAGG + Intergenic
1170068837 20:12343595-12343617 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1170106263 20:12756263-12756285 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1170165772 20:13359352-13359374 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1170680405 20:18520917-18520939 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1172241020 20:33412499-33412521 GGCCCTGTTCCCAGTGCCCCTGG - Intronic
1172623600 20:36335063-36335085 GGAGCTGGCACCTGAGCCCCTGG + Intronic
1173101945 20:40095739-40095761 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1173118901 20:40271449-40271471 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1173380461 20:42535087-42535109 GGCGCTGTTACCAAAGTCCCTGG + Intronic
1173763747 20:45587517-45587539 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1174534421 20:51239856-51239878 CGTGCTGTTTCCAGAGCCACAGG - Intergenic
1175159307 20:56995994-56996016 TGAGCTGTTACCGGAGCCCCAGG - Intergenic
1175855728 20:62119930-62119952 GGAGCTGGCCTCTGAGCCCCCGG - Intergenic
1175875701 20:62228267-62228289 TGTGCTGTTCCCAGAGCTGCTGG + Intergenic
1175894173 20:62328787-62328809 GGAGTTGGTGCCAGAGCCCAAGG - Intronic
1175940234 20:62534427-62534449 GGTGCCCTTCCCACAGCCCCCGG + Intergenic
1176034714 20:63030598-63030620 GGAGCTGGACCCAGAGCCAGGGG + Intergenic
1176047573 20:63100793-63100815 GGAGCTGTTTCTAGGGCCCCAGG + Intergenic
1176121903 20:63457810-63457832 GCTGCAGCTCCCAGAGCCCCTGG - Intronic
1177062982 21:16396654-16396676 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1178409816 21:32353839-32353861 GCAATTGATCCCAGAGCCCCTGG + Intronic
1178502208 21:33134856-33134878 GGACCTGTTCTCAGTGACCCTGG - Intergenic
1179488468 21:41725917-41725939 GGGGCTGTGCCCAGAGCAGCGGG + Intergenic
1179524108 21:41964501-41964523 GCAGCTGGTCCCAGAGCTACAGG - Intergenic
1180480551 22:15749547-15749569 GGAGCTGCTGCCAGCGCCACAGG - Intergenic
1180863006 22:19097971-19097993 GGAACTTTTCCCTGAGCCCAGGG - Intronic
1182234579 22:28865331-28865353 GCATCTGTTCCCACAGCACCTGG - Intergenic
1182732308 22:32505168-32505190 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1182998634 22:34836704-34836726 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1183060414 22:35333290-35333312 GGATCTGTCACCAGGGCCCCAGG - Intronic
1183450782 22:37893781-37893803 GGAGCAGTTAAGAGAGCCCCAGG - Intergenic
1183649173 22:39144520-39144542 CCAGCCCTTCCCAGAGCCCCGGG - Intronic
1184284841 22:43464711-43464733 TGAGCTGTGGCCAGAGTCCCAGG - Intronic
1184322841 22:43756274-43756296 GGATCTGAACCCAGAGCACCTGG - Intronic
1184389572 22:44195556-44195578 GCCGCTGTTCCCAGACCCCAAGG + Intronic
1184464769 22:44662357-44662379 GCAGGTGTTCCAGGAGCCCCAGG + Intergenic
1184522333 22:45002515-45002537 GGTGCTGGACCCAGAGCCCTGGG - Intronic
1184726262 22:46348449-46348471 GGTGCTCTACCCAGAGACCCAGG - Intronic
1184833050 22:47002747-47002769 AGAGCTGTTCCCTGGGGCCCCGG + Intronic
1185162044 22:49235889-49235911 GGAGCTGCACGCAGGGCCCCAGG + Intergenic
1185245650 22:49771504-49771526 GGCGCTGCTCCCAGAGCGCGAGG - Intergenic
1185336956 22:50275047-50275069 GGAACTGCTCCCAGTCCCCCCGG + Exonic
949162065 3:893988-894010 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
949190370 3:1243131-1243153 GCAGCCACTCCCAGAGCCCCTGG - Intronic
949671183 3:6400070-6400092 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
950148729 3:10669681-10669703 GGGACTGTGCCCAGAGACCCTGG + Intronic
950638128 3:14330444-14330466 GGAGCTGTGCGGAGAGCCGCTGG - Intergenic
950866936 3:16196990-16197012 CCAGGTGTTCCCAGAGCCTCTGG - Intronic
950926528 3:16746708-16746730 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
951298782 3:20970831-20970853 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
951316289 3:21192519-21192541 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
951888949 3:27551448-27551470 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
952343530 3:32464729-32464751 GCAGCCACTCCCAGAGCCCCTGG - Intronic
952896025 3:38079599-38079621 GCAGCCACTCCCAGAGCCCCTGG - Intronic
953077102 3:39581119-39581141 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
953098938 3:39807471-39807493 GGAGATGTTGCCAGAACCCAGGG + Intergenic
953177223 3:40563370-40563392 GCAGCCACTCCCAGAGCCCCTGG + Intronic
953472024 3:43175776-43175798 GCTGCTGTTTCCAGAGCCTCTGG - Intergenic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
953656535 3:44859002-44859024 GCAGCCACTCCCAGAGCCCCTGG - Intronic
953825673 3:46249623-46249645 GCAGCCACTCCCAGAGCCCCTGG - Intronic
953842096 3:46397174-46397196 GGAGCTGTCCCAAGAGCACCCGG - Intergenic
953880373 3:46688240-46688262 GCAGCTGTTGCAAGAGCCGCAGG + Exonic
954109062 3:48424245-48424267 GCCGCTGTTCACAGACCCCCTGG + Exonic
954327871 3:49873404-49873426 GGAGCTCTTTCCAGAGCCTGTGG - Intergenic
954450114 3:50567213-50567235 GGCGATGTTAACAGAGCCCCAGG - Intronic
955253396 3:57306069-57306091 GCAGCCACTCCCAGAGCCCCTGG + Intronic
957059868 3:75473351-75473373 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
957295266 3:78326193-78326215 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
957317279 3:78586466-78586488 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
957734836 3:84191121-84191143 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
958182917 3:90083455-90083477 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
958676783 3:97276304-97276326 GCAGCCACTCCCAGAGCCCCTGG - Intronic
959288322 3:104443238-104443260 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
959543666 3:107569961-107569983 GCAGCCACTCCCAGAGCCCCTGG - Intronic
960282845 3:115796825-115796847 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
961711595 3:128832511-128832533 GCAGCCCCTCCCAGAGCCCCTGG - Intergenic
961730617 3:128962096-128962118 GCAGCCACTCCCAGAGCCCCTGG + Intronic
961863104 3:129933727-129933749 GGAGCTCTGCCCTGACCCCCAGG - Intergenic
961881075 3:130061663-130061685 GCAGCTGCTCCCAGAGCCCCTGG + Intergenic
962205596 3:133431519-133431541 GCAGCCACTCCCAGAGCCCCTGG + Intronic
962349989 3:134649722-134649744 GGAGCTGCCTCCAGAGCCCTGGG - Intronic
962421368 3:135232019-135232041 GAGGCTGTTCCCAGTTCCCCAGG - Intronic
963008875 3:140751087-140751109 TGGGCTCTTCCCAGAGCCCTGGG + Intergenic
963058653 3:141207354-141207376 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963111809 3:141694606-141694628 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
963425248 3:145115370-145115392 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963456635 3:145554495-145554517 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
963468640 3:145712788-145712810 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963520473 3:146355938-146355960 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963521652 3:146364443-146364465 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963653376 3:148013939-148013961 GGATCTGTCCTCAGGGCCCCTGG - Intergenic
963663372 3:148154041-148154063 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
963684361 3:148416738-148416760 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
964067924 3:152599833-152599855 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
964438156 3:156675160-156675182 GGAGCCCTTCCCAGACCCCGGGG + Exonic
965070355 3:163909933-163909955 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
965262622 3:166504105-166504127 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
965286706 3:166827423-166827445 GAAGCTACTCCCAGAGCCTCTGG - Intergenic
965336358 3:167433605-167433627 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
965624854 3:170675842-170675864 GCAGCCACTCCCAGAGCCCCTGG - Intronic
965640009 3:170821278-170821300 GCAGCCACTCCCAGAGCCCCTGG - Intronic
965713438 3:171578804-171578826 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
966064372 3:175800178-175800200 GGAGTTGTTCCCAGTGCCAGAGG + Intronic
966085460 3:176063725-176063747 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
966105059 3:176324943-176324965 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
966232818 3:177669159-177669181 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
966398418 3:179524253-179524275 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967005326 3:185377852-185377874 GCAGCCACTCCCAGAGCCCCTGG - Intronic
967152153 3:186660405-186660427 GCAGCCACTCCCAGAGCCCCTGG + Intronic
967212137 3:187178849-187178871 GCAGCCACTCCCAGAGCCCCTGG - Intronic
967496252 3:190146895-190146917 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
967561410 3:190922495-190922517 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
967624622 3:191669808-191669830 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967643800 3:191898678-191898700 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967658079 3:192074405-192074427 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
967946341 3:194807105-194807127 GGAGATCTTCCCTGAGGCCCTGG - Intergenic
968817829 4:2830885-2830907 AGAGGTGTTCGCAGAGCCCTGGG - Intronic
968993410 4:3929768-3929790 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
969003783 4:4003536-4003558 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
969605369 4:8199713-8199735 GGCTCTGCTCCCAGACCCCCAGG - Intronic
969654069 4:8486102-8486124 GCAGCCACTCCCAGAGCCCCTGG - Intronic
969749084 4:9096649-9096671 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
969778172 4:9375063-9375085 TGAGCTGTGGCCAGAGCCCAAGG - Intergenic
970042116 4:11808663-11808685 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
970087571 4:12366152-12366174 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
970202841 4:13627377-13627399 GGAACTGGTCGAAGAGCCCCTGG + Exonic
970256393 4:14173850-14173872 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
970532766 4:17000052-17000074 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
970604673 4:17667940-17667962 GGAGCTGTACACACAGGCCCAGG - Intronic
971180591 4:24325600-24325622 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
971200164 4:24503397-24503419 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
971379673 4:26085351-26085373 GGAGCTGGTCTCAGAGGACCTGG - Intergenic
973751153 4:54022194-54022216 GCAGCCACTCCCAGAGCCCCTGG + Intronic
975865063 4:78717182-78717204 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
976558596 4:86476977-86476999 GCAGCCACTCCCAGAGCCCCTGG + Intronic
976696566 4:87924255-87924277 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
976884541 4:89968116-89968138 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977010346 4:91626477-91626499 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
977012896 4:91657946-91657968 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977062481 4:92274814-92274836 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977075175 4:92442285-92442307 GGAGCCACTCTCAGAGCCCCTGG - Intronic
977198401 4:94087948-94087970 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977217128 4:94296539-94296561 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977225316 4:94386792-94386814 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
977372666 4:96159763-96159785 GGATCTCTTCCCAGGGCCCAGGG - Intergenic
977446411 4:97137925-97137947 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978001091 4:103557087-103557109 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978303200 4:107293744-107293766 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
978438639 4:108711414-108711436 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
979054593 4:115978977-115978999 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
979146647 4:117254487-117254509 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
979171382 4:117603633-117603655 GCAGCTACTTCCAGAGCCCCTGG - Intergenic
979379968 4:119996308-119996330 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
979850281 4:125564960-125564982 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
979895133 4:126148460-126148482 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980284976 4:130769747-130769769 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980388955 4:132120587-132120609 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980472411 4:133267016-133267038 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980514795 4:133841577-133841599 GGAGCTGTTCCAGGAACCCTGGG - Intergenic
980527897 4:134014561-134014583 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
980575606 4:134681230-134681252 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980611750 4:135170614-135170636 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
980903967 4:138930258-138930280 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
981040274 4:140215881-140215903 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
981525239 4:145701488-145701510 GCAGCCACTCCCAGAGCCCCTGG + Intronic
981539751 4:145835132-145835154 GCAGCCACTCCCAGAGCCCCTGG + Intronic
981817669 4:148849645-148849667 GCAGCTGGTCCCTGAGCTCCAGG + Intergenic
982083939 4:151815926-151815948 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982233752 4:153232954-153232976 GGAGCTGTCCCCTGGGCCACTGG + Intronic
982318837 4:154058667-154058689 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
982396690 4:154922162-154922184 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982497080 4:156106790-156106812 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
982985406 4:162200487-162200509 GGAGCGGCTCACAGAGCCCAGGG + Intergenic
983023902 4:162711488-162711510 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983055517 4:163095475-163095497 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983345587 4:166522909-166522931 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983448952 4:167887592-167887614 CGAGCTGGTCCCAGAGCCACAGG + Intergenic
983452364 4:167925281-167925303 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983659600 4:170118841-170118863 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
983805763 4:171989354-171989376 GCAGCCACTCCCAGAGCCCCTGG - Intronic
983883730 4:172959693-172959715 GCAGCCACTCCCAGAGCCCCTGG - Intronic
983998982 4:174217796-174217818 GAGGCTGTGGCCAGAGCCCCAGG + Intergenic
984165329 4:176298172-176298194 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
984411756 4:179405605-179405627 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
984437290 4:179722833-179722855 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
984866010 4:184281348-184281370 AGTCCTGTCCCCAGAGCCCCAGG - Intergenic
985057371 4:186047521-186047543 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
985228525 4:187789360-187789382 GCAGCTGTTCCCAGAGCACTGGG - Intergenic
985300265 4:188481031-188481053 GCACCTGTTCCTAGAGCCCATGG - Intergenic
985347514 4:189022095-189022117 GGAGGAGGTCCCAGAGGCCCTGG + Intergenic
985389841 4:189482787-189482809 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
985435750 4:189928240-189928262 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
985491478 5:182178-182200 GGAGCCCTGCCCACAGCCCCTGG + Exonic
985678676 5:1245030-1245052 TGAGCAGTGCCCAGAGCCCAGGG + Intronic
986009332 5:3698293-3698315 GGAGCTCTTCCCATTGTCCCTGG + Intergenic
986193563 5:5517942-5517964 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
986388906 5:7265972-7265994 GAAGCCACTCCCAGAGCCCCTGG + Intergenic
986555013 5:9001869-9001891 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
986905801 5:12492188-12492210 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
986919561 5:12665863-12665885 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
987282066 5:16422401-16422423 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
987595113 5:19988152-19988174 GCAGCTGTGCCCAGAGCTCTGGG - Intronic
987755855 5:22097232-22097254 GCAGCCACTCCCAGAGCCCCTGG + Intronic
988901065 5:35733031-35733053 GGATATGTTCCCAGACCCACAGG - Intronic
989139940 5:38192267-38192289 GGAGATGTTTCCAAAACCCCTGG - Intergenic
990134605 5:52630587-52630609 GGACCTGTTCCCAGACCCCAGGG - Intergenic
990565095 5:57020304-57020326 GCAGCCGCTCCCAGAGTCCCTGG - Intergenic
991324523 5:65415936-65415958 TGAGATGATCCCAGTGCCCCTGG - Intronic
992268152 5:75038418-75038440 GAAGGTGTTCCCAGTACCCCAGG - Intergenic
992394692 5:76359741-76359763 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
992627685 5:78649237-78649259 GGAACTGCTCCTAGCGCCCCGGG - Intronic
992627688 5:78649249-78649271 GGAGCAGTTCCCCCAGACCCGGG + Intronic
992960859 5:81955645-81955667 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
993192741 5:84700866-84700888 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
993503793 5:88689106-88689128 GAGGCTCTTCCCAGGGCCCCCGG + Intergenic
993836732 5:92826362-92826384 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
994126082 5:96170212-96170234 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
994295174 5:98081452-98081474 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
994532518 5:100987578-100987600 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
994775711 5:104034004-104034026 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
994778919 5:104067511-104067533 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
995296700 5:110532228-110532250 GCAGCCACTCCCAGAGCCCCTGG + Intronic
995769411 5:115652918-115652940 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
995798184 5:115962884-115962906 GTAGCTGGTCCCAGGGCCCCGGG - Exonic
995899338 5:117049688-117049710 GCAGCAACTCCCAGAGCCCCTGG - Intergenic
996052645 5:118950531-118950553 GCAGCCACTCCCAGAGCCCCTGG - Intronic
996203233 5:120700914-120700936 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996344793 5:122476928-122476950 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996509928 5:124306179-124306201 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
996574969 5:124969924-124969946 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
996745418 5:126842882-126842904 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
997213008 5:132088551-132088573 GGAGCTGCTCCCAGAACCAGTGG - Intergenic
997253905 5:132411836-132411858 GGGGCTGTTTCCACAGCCCTGGG - Intronic
997383718 5:133456150-133456172 GGAGCTCCTCCAAGAGTCCCTGG - Intronic
997520868 5:134524298-134524320 GGGTCTGTTCCCGGAGCCGCGGG - Intronic
997678833 5:135734998-135735020 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
997769652 5:136542936-136542958 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
997950863 5:138241765-138241787 GGTGCTGTTCCCAGCGCTCTCGG - Intergenic
998172613 5:139881380-139881402 AGACCTGTTCCCAGATACCCGGG + Intronic
998337680 5:141387962-141387984 GGATCTGCTCACAGAGCGCCGGG - Exonic
998338790 5:141398205-141398227 GGATCTGCTCACAGAGCGCCGGG - Exonic
998693675 5:144614661-144614683 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
999251547 5:150185346-150185368 GCAGCTGGCACCAGAGCCCCCGG - Intergenic
999618839 5:153453033-153453055 GCAGCTACTCCCAGAGCCCCTGG - Intergenic
999658450 5:153833662-153833684 GGAGCTGTACCCAGATGGCCAGG + Intergenic
1000439749 5:161250879-161250901 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1000456402 5:161454892-161454914 AAATCTGTTCCCAGAGCCCCTGG + Intronic
1000513304 5:162209581-162209603 GGAGGTGATCCCAGAGGCACTGG - Intergenic
1000519380 5:162278713-162278735 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1000606961 5:163336411-163336433 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1001009892 5:168087884-168087906 AGATCTTCTCCCAGAGCCCCTGG + Intronic
1001331424 5:170765357-170765379 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1002610932 5:180418049-180418071 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1002710266 5:181190925-181190947 GGAGCCGTCCCGAGACCCCCAGG + Intergenic
1003430137 6:6031106-6031128 GCAGCCGCTCCCAGAACCCCTGG - Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004051758 6:12088494-12088516 CCAGTTGTGCCCAGAGCCCCAGG + Intronic
1004349712 6:14880441-14880463 GGGGCTGCTGCCTGAGCCCCTGG - Intergenic
1004575251 6:16888343-16888365 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1004768545 6:18757389-18757411 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1004837031 6:19541291-19541313 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1004926962 6:20425355-20425377 GGAGCTGTGCGCACAACCCCAGG + Intronic
1005014630 6:21364831-21364853 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1006037959 6:31228871-31228893 GGAGCAGTTTCCAGAACCCAAGG - Intergenic
1006211929 6:32403121-32403143 GGGCTGGTTCCCAGAGCCCCAGG - Exonic
1006801839 6:36764799-36764821 GGAGCTGTTTGCAGAGAGCCAGG - Intronic
1007142637 6:39591188-39591210 GGAGCCCGTCCCAGCGCCCCAGG - Intronic
1007173503 6:39880756-39880778 GGAGATGTTATCAGAGGCCCGGG - Intronic
1007263367 6:40579257-40579279 GGAGCTGAGGCTAGAGCCCCTGG - Intronic
1007274170 6:40661282-40661304 GGTCCTGTTCCCAAAGCCCCTGG - Intergenic
1007813589 6:44504051-44504073 GCAGCCCTTCCCTGAGCCCCTGG + Intergenic
1008850183 6:56014139-56014161 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1009183988 6:60551979-60552001 GGAGCTGGTCCTAAAGCCCTTGG - Intergenic
1009269846 6:61602489-61602511 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009359381 6:62793891-62793913 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009379169 6:63007684-63007706 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1009464362 6:63952293-63952315 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1010316097 6:74452248-74452270 GGAGCTGGAGCAAGAGCCCCTGG - Intergenic
1010586668 6:77663879-77663901 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1010662342 6:78585781-78585803 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1010829662 6:80513629-80513651 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1010841286 6:80651121-80651143 GAAGCCACTCCCAGAGCCCCTGG - Intergenic
1010894517 6:81348461-81348483 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1011770913 6:90673536-90673558 GCAGCCAATCCCAGAGCCCCTGG - Intergenic
1012014364 6:93833402-93833424 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1012066515 6:94557268-94557290 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1012315852 6:97781985-97782007 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1012689602 6:102295312-102295334 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1013843651 6:114425647-114425669 GCAGCCACTCCCAGAGCCCCGGG - Intergenic
1014279121 6:119420911-119420933 TTAGCTGTTCCCAGAGACTCTGG - Intergenic
1014360131 6:120465590-120465612 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1014396094 6:120927576-120927598 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1014454842 6:121623763-121623785 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1014612115 6:123559020-123559042 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1014613369 6:123571069-123571091 GGATCTGTGCCCAAATCCCCCGG - Exonic
1014614643 6:123585612-123585634 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1014891572 6:126851140-126851162 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015271403 6:131341267-131341289 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015278183 6:131405199-131405221 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1015288017 6:131507606-131507628 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1015323860 6:131904072-131904094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1016000275 6:139034336-139034358 GGAGCTCTGCCCACAGCCCCAGG + Intronic
1016034552 6:139373396-139373418 CGAGCTGCTGCCAGAGCCGCCGG + Exonic
1016056970 6:139588205-139588227 GGAACTGGTCACAGAGGCCCTGG + Intergenic
1016248890 6:142018194-142018216 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1016518834 6:144925558-144925580 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1016535731 6:145106473-145106495 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1016650263 6:146453739-146453761 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1017269842 6:152492600-152492622 GAAGCCACTCCCAGAGCCCCTGG + Intronic
1017389531 6:153923871-153923893 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1018084465 6:160289895-160289917 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1018495376 6:164342057-164342079 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1018521442 6:164655475-164655497 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1019179575 6:170177876-170177898 GGAGCTGGCCCCACAGCGCCAGG - Intergenic
1019181326 6:170188799-170188821 GCAGCTGTCCCCTGTGCCCCTGG - Intergenic
1019190975 6:170250595-170250617 GCAGCTGCTCCCAGAGCCTTTGG - Intergenic
1019368145 7:645805-645827 GGGGGTGCTCCCTGAGCCCCAGG + Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1019427177 7:983244-983266 AGAGCAGCCCCCAGAGCCCCAGG - Exonic
1019529112 7:1494862-1494884 GGTGCTGTTCACAGAGCAGCCGG - Exonic
1020316078 7:6906175-6906197 GCAGCTGCTCCCAGAGCCCTTGG + Intergenic
1020323918 7:6959991-6960013 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1020532687 7:9356744-9356766 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1020541117 7:9461879-9461901 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1021393655 7:20122989-20123011 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1021410968 7:20330190-20330212 GGGGCTGTTCCCGGAGCGACTGG - Intergenic
1021810690 7:24398663-24398685 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1021862841 7:24923837-24923859 GGGGCAGCTCTCAGAGCCCCTGG - Intronic
1021902279 7:25298061-25298083 GAAGCTGTTGCCAGAGCACATGG + Intergenic
1021977867 7:26027511-26027533 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1022372901 7:29787233-29787255 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1022701384 7:32763196-32763218 GGGTCTGATCCCAGAGCCTCAGG + Intergenic
1022936888 7:35186971-35186993 GGGTCTGATCCCAGAGCCTCAGG + Intergenic
1023698857 7:42873931-42873953 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1023745792 7:43321199-43321221 GGAGCTGTGGCCAGAGCCAAAGG - Intronic
1024117255 7:46206100-46206122 GGAGAAGTGGCCAGAGCCCCAGG + Intergenic
1024200419 7:47101118-47101140 GGAGATGTGCCCTGAGCACCTGG + Intergenic
1026979174 7:74516656-74516678 GGAGGGGTACCCAGAGGCCCTGG + Intronic
1027158345 7:75784315-75784337 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1027234441 7:76289703-76289725 GAAGCTGTTCACAGAAGCCCTGG + Intergenic
1027354452 7:77342084-77342106 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1027851974 7:83462051-83462073 GCAGCCATTCCCAGAGCCCCTGG + Intronic
1028370571 7:90087275-90087297 GGGCCTGGTCCCAAAGCCCCAGG + Intergenic
1028373230 7:90118609-90118631 GGGTCTGATCCCAGAGCCTCAGG - Intergenic
1028589880 7:92483112-92483134 GCAGCCAATCCCAGAGCCCCTGG - Intergenic
1029833122 7:103281078-103281100 GGGTCTGATCCCAGAGCCTCAGG + Intergenic
1030441656 7:109595350-109595372 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1030751472 7:113236902-113236924 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1031004695 7:116457870-116457892 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1031296644 7:120011275-120011297 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1031355163 7:120780468-120780490 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1031525619 7:122819307-122819329 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1031685875 7:124731425-124731447 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1031727902 7:125262226-125262248 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1033283137 7:140019778-140019800 GCTGCTTTCCCCAGAGCCCCTGG + Intronic
1033321435 7:140343285-140343307 AACGCTGTTCCCAGAGCCCAAGG - Intronic
1033675920 7:143540546-143540568 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1033695914 7:143788893-143788915 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1033909442 7:146246703-146246725 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1034084804 7:148313374-148313396 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1034468337 7:151242816-151242838 GGAGCTGGTCCCCGAGTCCCAGG - Exonic
1034574506 7:151985563-151985585 GGAGCAGTTCCCTGGGCCCCTGG - Intronic
1035245981 7:157562151-157562173 CGAGCTGTCCCCAGAGCCCTGGG - Intronic
1035245988 7:157562174-157562196 GGAGCTGTCCCCAGAGCCCTGGG - Intronic
1035471165 7:159109677-159109699 ACAGCTGTTCCCTGACCCCCAGG + Intronic
1035880638 8:3241540-3241562 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1035887076 8:3302959-3302981 GCAACTGCTCCCAGAGCCCCAGG + Intronic
1036070897 8:5439965-5439987 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1036275629 8:7349059-7349081 TGAGCTGTGGCCAGAGCCCAAGG - Intergenic
1036281511 8:7404822-7404844 GCAGCCATTCCCACAGCCCCTGG + Intergenic
1036339960 8:7906750-7906772 GCAGCCATTCCCACAGCCCCTGG - Intergenic
1036472303 8:9062759-9062781 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1036580014 8:10065192-10065214 GGAGTGCTTCTCAGAGCCCCAGG + Intronic
1036766863 8:11554917-11554939 GGACTTGTGCCAAGAGCCCCTGG + Intronic
1036841051 8:12122052-12122074 TGAGCTGTGGCCAGAGCCCAAGG + Intergenic
1039059868 8:33565100-33565122 GAAGCAGTTCCCAGATCCCCTGG - Intronic
1039498972 8:38002000-38002022 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1039818293 8:41114080-41114102 GGAACTATTCCCAGGGCTCCAGG + Intergenic
1040648049 8:49421885-49421907 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1041605762 8:59780817-59780839 GAGGTTGTTCCCACAGCCCCAGG - Intergenic
1041651814 8:60309824-60309846 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1042453586 8:68975557-68975579 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1042707398 8:71677300-71677322 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1043353642 8:79389429-79389451 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1043720932 8:83546356-83546378 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1044148488 8:88745539-88745561 GTAGCCACTCCCAGAGCCCCTGG - Intergenic
1044258589 8:90093528-90093550 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1044380580 8:91528348-91528370 GGAGCTGTTCCCAGAGGAAGAGG - Intergenic
1044417112 8:91950354-91950376 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1044922021 8:97177461-97177483 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1044925188 8:97203305-97203327 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1045197552 8:99946256-99946278 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1045644809 8:104288320-104288342 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046074936 8:109303197-109303219 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1046294146 8:112198209-112198231 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
1046440042 8:114243723-114243745 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046443273 8:114284375-114284397 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1046559307 8:115816994-115817016 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1047473664 8:125204303-125204325 GGAGGTGTTCCCAGACTTCCTGG + Intronic
1047721641 8:127645588-127645610 GGAGCTGAGACCAGAACCCCTGG - Intergenic
1047829517 8:128615232-128615254 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1047967052 8:130053311-130053333 GGAACTGTTCCCTGAGTCCGAGG - Exonic
1048097635 8:131312591-131312613 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1048135495 8:131743107-131743129 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1048321948 8:133406844-133406866 GGAACTTTTCCCAGATCCCTGGG - Intergenic
1048455052 8:134570129-134570151 CCTGCTGTTCCCAGAGCCCGGGG + Intronic
1048585393 8:135770465-135770487 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048728393 8:137411599-137411621 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048764210 8:137828147-137828169 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1048901790 8:139044795-139044817 GCAGTCGGTCCCAGAGCCCCAGG - Intergenic
1049353672 8:142177409-142177431 GGAGCGGTCGCCAGCGCCCCGGG - Intergenic
1049357597 8:142196401-142196423 GGACCTCTTCCCAGAGCCAACGG + Intergenic
1049433101 8:142574309-142574331 CGTGCTGCTCCCCGAGCCCCAGG - Intergenic
1049689035 8:143950769-143950791 GGAGCTTCTCGCAGCGCCCCGGG - Exonic
1049724535 8:144139507-144139529 GGAGCTGGCCCCAGAGCCATGGG + Exonic
1049868790 8:144957583-144957605 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1050117632 9:2277953-2277975 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1050258076 9:3814475-3814497 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1051909527 9:22137689-22137711 GGATCTGTTTCAAGAGCCCAAGG + Intergenic
1052163110 9:25290059-25290081 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1052191859 9:25671313-25671335 GCAGCCGCTCCCAGAACCCCTGG + Intergenic
1052653362 9:31328801-31328823 GCAGCTACTCCCAGAGCCCCTGG + Intergenic
1054807459 9:69408076-69408098 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1055233091 9:74088050-74088072 GTAGCCACTCCCAGAGCCCCTGG + Intergenic
1055375902 9:75648166-75648188 GCAGCTGCTGCCAGGGCCCCAGG - Intergenic
1055626751 9:78183194-78183216 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1055767011 9:79674169-79674191 AGAGCTGTCTCCAGAGCCCATGG - Intronic
1055810076 9:80139798-80139820 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056061186 9:82886142-82886164 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056323916 9:85461033-85461055 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056363738 9:85883072-85883094 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056522475 9:87413313-87413335 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1056883007 9:90414962-90414984 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1057354202 9:94321380-94321402 GGAGCTGCTCCCAGAGTTCTGGG + Intronic
1057378019 9:94542214-94542236 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1057501031 9:95596766-95596788 GCAGCTGCTCCCAGGGTCCCTGG + Intergenic
1057653562 9:96936255-96936277 GGAGCTGCTCCCAGAGTTCTGGG - Intronic
1057708089 9:97412190-97412212 GGAGCTGGGCCCAGAGACGCGGG + Exonic
1057873665 9:98736528-98736550 GGGGCTGTTGCCAGGGGCCCTGG + Exonic
1057982110 9:99672545-99672567 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1059606679 9:115842528-115842550 GCAGCCACTCCCAGAGCCCCAGG - Intergenic
1059838769 9:118188786-118188808 GGAACTGTTCCCACAGAGCCTGG + Intergenic
1059863458 9:118488997-118489019 GCAGCGACTCCCAGAGCCCCTGG - Intergenic
1060115280 9:120935488-120935510 GGAGCTGGTGCCAGGGCCCCAGG - Intergenic
1060318443 9:122533957-122533979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1060737850 9:126077951-126077973 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1060980643 9:127789659-127789681 CGGGCTGCTCCCAGAGCCCAGGG - Exonic
1060991551 9:127852492-127852514 GGAGCTGGTCCCAGTGCACCAGG - Intronic
1061132678 9:128716897-128716919 GGATGTCTTCCCCGAGCCCCAGG + Exonic
1061181383 9:129027064-129027086 GGACCTGCTCCCAGAACCCTGGG + Intronic
1061443516 9:130623767-130623789 GGTGCTGCACCGAGAGCCCCGGG - Intronic
1061486099 9:130921180-130921202 GGAACTGTGCCCCGAGACCCTGG - Intronic
1061583099 9:131549473-131549495 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1062053290 9:134458194-134458216 GGTGCTGTGCCCTGAGACCCAGG + Intergenic
1062196712 9:135278258-135278280 TGAGATGTTCCCACAGCACCGGG - Intergenic
1062273859 9:135721559-135721581 GGAGCCAATCCCAGAGCCTCGGG + Intronic
1062417158 9:136457372-136457394 GGAGGGCTTGCCAGAGCCCCCGG - Intronic
1185858400 X:3556447-3556469 GCAGCGACTCCCAGAGCCCCTGG - Intergenic
1185991089 X:4893979-4894001 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1186112836 X:6275501-6275523 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1186179077 X:6955097-6955119 GGAGGTGATCCCAAAGCCCTTGG - Intergenic
1186493972 X:9997255-9997277 AGAGCTTTTCCCTCAGCCCCTGG + Intergenic
1187086492 X:16048010-16048032 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1187178127 X:16915475-16915497 GGAGCTGTTCCTGGAGCTACTGG + Intergenic
1187480354 X:19649271-19649293 GGGTCTGTTTCCAGATCCCCCGG - Intronic
1188332990 X:28895913-28895935 GGAGCCACTCCCAGAGCCCGTGG - Intronic
1188431053 X:30105731-30105753 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1188463347 X:30452417-30452439 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1188552682 X:31379892-31379914 GCAGCCACTCCCAGAGCCCCTGG + Intronic
1189031782 X:37459091-37459113 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1190327015 X:49212778-49212800 GGAGCTGTCCTCAGAGCTCTGGG + Exonic
1190364102 X:49675593-49675615 CCATTTGTTCCCAGAGCCCCTGG + Intergenic
1190560809 X:51683167-51683189 CTCTCTGTTCCCAGAGCCCCTGG - Intergenic
1190563482 X:51710154-51710176 CTCTCTGTTCCCAGAGCCCCTGG + Intergenic
1191014164 X:55791629-55791651 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1191805782 X:65132957-65132979 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1192706167 X:73530053-73530075 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1192914103 X:75635588-75635610 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1193731084 X:85104647-85104669 GGACCTGCTCCCTCAGCCCCAGG + Intronic
1193885957 X:86984193-86984215 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1194186220 X:90776640-90776662 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1194308514 X:92276381-92276403 GCAGCCACTCCCAGAGCCCCTGG - Intronic
1194351316 X:92826879-92826901 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1194367134 X:93025321-93025343 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1194502953 X:94702141-94702163 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1194660716 X:96626414-96626436 GTAGCCACTCCCAGAGCCCCTGG + Intergenic
1194822741 X:98527593-98527615 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1195291125 X:103432851-103432873 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1195841516 X:109180809-109180831 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196073109 X:111546305-111546327 GCAGCCATTCCCAGAGCCCCTGG + Intergenic
1196138423 X:112234513-112234535 GGAGCTGATCCCAAAGCCAGGGG - Intergenic
1196165571 X:112533004-112533026 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196300040 X:114042371-114042393 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196330853 X:114469151-114469173 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196341689 X:114604624-114604646 GCAGCCATTCCCAGAGCCCCTGG - Intronic
1196525443 X:116724272-116724294 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1196572527 X:117281547-117281569 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1196773826 X:119321087-119321109 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1197064946 X:122224423-122224445 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1197892103 X:131278414-131278436 GGAGTTATCCCCAGTGCCCCTGG - Intronic
1198486828 X:137095540-137095562 GGAGCCTGTCCCACAGCCCCCGG - Intergenic
1198511178 X:137353338-137353360 GGAGAAGTTCTCAGAGGCCCAGG + Intergenic
1198983725 X:142426887-142426909 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1199576508 X:149318054-149318076 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1200076700 X:153554759-153554781 GGAGAAGTTGCCAGTGCCCCCGG - Intronic
1200084977 X:153599461-153599483 GGAGCTGCTCCGAGACCCGCGGG + Intronic
1200532810 Y:4358719-4358741 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1200659641 Y:5943569-5943591 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1200675347 Y:6141577-6141599 GCAGCCACTCCCAGAGCCCCTGG + Intergenic
1201234226 Y:11894456-11894478 GCAGCCACTCCCAGAGCCCCTGG - Intergenic
1201724789 Y:17140020-17140042 GAAGCCACTCCCAGAGCCCCTGG - Intergenic