ID: 953600362 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:44357152-44357174 |
| Sequence | CCCATTGCTTTGAGAGGGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4725 | |||
| Summary | {0: 1, 1: 1, 2: 18, 3: 384, 4: 4321} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953600358_953600362 | 4 | Left | 953600358 | 3:44357125-44357147 | CCAGGCATGGTGGCTCATGACTG | 0: 108 1: 9168 2: 42140 3: 105233 4: 178558 |
||
| Right | 953600362 | 3:44357152-44357174 | CCCATTGCTTTGAGAGGGTAAGG | 0: 1 1: 1 2: 18 3: 384 4: 4321 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953600362 | Original CRISPR | CCCATTGCTTTGAGAGGGTA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||