ID: 953600362

View in Genome Browser
Species Human (GRCh38)
Location 3:44357152-44357174
Sequence CCCATTGCTTTGAGAGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4725
Summary {0: 1, 1: 1, 2: 18, 3: 384, 4: 4321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953600358_953600362 4 Left 953600358 3:44357125-44357147 CCAGGCATGGTGGCTCATGACTG 0: 108
1: 9168
2: 42140
3: 105233
4: 178558
Right 953600362 3:44357152-44357174 CCCATTGCTTTGAGAGGGTAAGG 0: 1
1: 1
2: 18
3: 384
4: 4321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953600362 Original CRISPR CCCATTGCTTTGAGAGGGTA AGG Intronic
Too many off-targets to display for this crispr