ID: 953604746

View in Genome Browser
Species Human (GRCh38)
Location 3:44404433-44404455
Sequence CAGAAAAAGGCTAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953604746 Original CRISPR CAGAAAAAGGCTAAGGAAGC AGG (reversed) Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904351143 1:29907463-29907485 CTGAAAAAAGGTAAGGAAGTTGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905302160 1:36992845-36992867 CACAAAAAGGCTACTGAACCAGG + Intronic
905467375 1:38165590-38165612 CAGAAAAAGGCTGTTGGAGCTGG + Intergenic
906436482 1:45801236-45801258 GAGAAAAAGGCTTACGTAGCTGG - Intronic
907015620 1:51009869-51009891 CAGAAAAATGCTGAGGAGACAGG + Intergenic
907138254 1:52159310-52159332 CAGAAATTGACTAAGAAAGCAGG - Intronic
909190702 1:72545952-72545974 AAGAAAAAGACTGAGGAAGCAGG - Intergenic
909937745 1:81573342-81573364 AGGAAAAAGGTTAAGGAAGGGGG - Intronic
910163335 1:84297911-84297933 CAGAGAAAAGCTAAAGATGCAGG - Intergenic
910180657 1:84479207-84479229 AAGTAAAAGGTTAAGGAAGGGGG + Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910770502 1:90826562-90826584 AACAAAAAGGCCAAGGAAGAGGG - Intergenic
911669192 1:100588982-100589004 CTGAAATAGGCAAAGGAATCAGG - Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
912554621 1:110507260-110507282 CAGAAAAAGGGAAAGAAAGACGG - Intergenic
913131439 1:115841150-115841172 GAGATAAAGGCTTAGGAAGGGGG + Exonic
913366199 1:118041957-118041979 GAGAAGAAGGGTAAAGAAGCTGG - Exonic
913412186 1:118564302-118564324 CAGAAGCAGCCTAAGGAAGATGG - Intergenic
914320559 1:146555431-146555453 CAGGAAAAAGGAAAGGAAGCAGG + Intergenic
914459542 1:147870397-147870419 AAGAATAAGGCTTAGGAAGCTGG + Intergenic
915252416 1:154600047-154600069 CAGAAAACGGCTTAGGGAGGAGG + Intronic
915287138 1:154860314-154860336 CAGAAAAAGGCTGAGAGAGTAGG - Intronic
915795644 1:158731068-158731090 CAGGAGAAAGCTAAGGAAACTGG + Intergenic
915883398 1:159697658-159697680 CAGAAAAAAGCTAACATAGCAGG + Intergenic
917021356 1:170591668-170591690 AAGAGAAAGGCTCAGGAAGATGG + Intergenic
917277158 1:173342962-173342984 CAGCAAGAGTCTAAGGAAGAAGG + Intergenic
917629063 1:176875287-176875309 CAGAAATTGGCTAAGGGAGGGGG + Intronic
918459321 1:184759431-184759453 CAGAAATAGTCCTAGGAAGCTGG + Intergenic
920264164 1:204709434-204709456 AAGATGAAGGCTAAGGAAGGAGG - Intergenic
920431288 1:205920914-205920936 CAGATCCTGGCTAAGGAAGCCGG + Intronic
921168537 1:212525413-212525435 TAGAAGAAGGCTAGGGAAGAAGG + Intergenic
921259452 1:213372498-213372520 CAGAAAAAAGCTAGGGTAGACGG - Intergenic
921356538 1:214289743-214289765 CAGAAAAACGCTGAGTGAGCAGG - Intronic
921704566 1:218307480-218307502 GATGAAAAGGTTAAGGAAGCTGG + Exonic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922303628 1:224325269-224325291 AAAAAAAAGACTCAGGAAGCTGG + Intronic
922367912 1:224883182-224883204 CAGAAAAGGGCTGAAGAAGGCGG + Intergenic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
924806285 1:247364399-247364421 CAGAAATAGGCTAAGATAGCCGG + Intergenic
924851840 1:247838856-247838878 CAGAAGAAGGCTGAGGAACTGGG - Intergenic
1063132262 10:3188573-3188595 CACAAACAGACTAAGGCAGCTGG - Intergenic
1064673869 10:17742204-17742226 CAGAAAGAGGGATAGGAAGCTGG + Intergenic
1065053857 10:21823024-21823046 CAGAAAAGGGATAAGAATGCAGG + Intronic
1065614202 10:27503874-27503896 TGGAGAAAGGCTAAGAAAGCTGG + Intergenic
1066023598 10:31328303-31328325 CATAAAAAGACTAAGTAACCCGG - Intronic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1067842216 10:49690097-49690119 CAGCAAAAAGCGAAGGCAGCAGG + Intronic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068798336 10:61109715-61109737 CAGGAAAAGACTAAGTAAGGAGG + Intergenic
1069002680 10:63283353-63283375 AAAAAAAAGGCTCAGAAAGCAGG - Intronic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1069422271 10:68257493-68257515 CAGAGAAAGCCTATTGAAGCTGG - Intergenic
1069944361 10:71975715-71975737 CACAGACAGGCCAAGGAAGCTGG - Intronic
1070416552 10:76195561-76195583 GAGAACAGGGCTAAGGAAACAGG - Intronic
1070741613 10:78907185-78907207 CAGAATGATGCTCAGGAAGCAGG + Intergenic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071427644 10:85575417-85575439 CAGAAAAAGATTAAGGGATCAGG - Intergenic
1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG + Intronic
1072697685 10:97616082-97616104 CAGAAAAGTGCTGAGGATGCTGG - Exonic
1072907628 10:99469142-99469164 CTGAAAAAGGCTAAGAGGGCAGG - Intergenic
1074050131 10:109874292-109874314 CAGAAGAAGGCAAAGAAAACAGG + Intronic
1074363287 10:112839382-112839404 CCGAAAAATGCTGAGGAACCCGG + Intergenic
1075670393 10:124260451-124260473 CAGGAAAGGGCTCAGGAAGCTGG - Intergenic
1076457674 10:130612113-130612135 CAGAAAAAGTCAAGGGAAGTTGG - Intergenic
1076466641 10:130687361-130687383 CAGTCAAAGGCTGAGGAGGCAGG + Intergenic
1077047473 11:552801-552823 CAGAGCATGGCTGAGGAAGCAGG - Intronic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078290074 11:10001240-10001262 GAAACAAAGGTTAAGGAAGCAGG - Intronic
1078387639 11:10906890-10906912 CAGAAAAATGTTAAGGATGATGG - Intergenic
1079491666 11:20995683-20995705 CACAATAAGGCAAAGAAAGCTGG - Intronic
1080417564 11:32083158-32083180 CGGCAAAAGGATAAGGAAGTAGG - Intronic
1080585191 11:33675385-33675407 CAGACACAGGCACAGGAAGCTGG + Intergenic
1080793206 11:35539488-35539510 CAGACCTAGGCTAAGGGAGCAGG + Intergenic
1081125702 11:39318479-39318501 CATAAAAAGGTTAAAGAAGAGGG + Intergenic
1083284249 11:61647767-61647789 CAGCAAAAGCATAAGGAACCAGG - Intergenic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1083540539 11:63508948-63508970 GAGAAAGAGGATGAGGAAGCTGG - Exonic
1084071322 11:66737794-66737816 CAGAAAGAGGTTGAGGAAGGAGG + Intergenic
1084483413 11:69434791-69434813 CAGACAAAGGCAAAGGCAGGAGG + Intergenic
1084913547 11:72410347-72410369 CAGAAACAGGCTTAGAGAGCAGG - Intronic
1087779172 11:102285148-102285170 CAGAAAGATGCCAATGAAGCTGG + Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088297197 11:108312310-108312332 CAGAAAAAAACTAATGAAGGTGG - Intronic
1090303795 11:125672759-125672781 CAGATAAAGGCTAAGGTTGGAGG - Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1091757173 12:3061599-3061621 CAGAAAAAGCCTAAGGGAAATGG - Intergenic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096770583 12:53933719-53933741 TAGAAAAGGGCTGAGGAAGGAGG + Intergenic
1097754294 12:63391563-63391585 CAGTAAAAGTCTAAGGTAGTGGG + Intergenic
1098241488 12:68471933-68471955 CAGGAAAAGTCTTAGGAAGAAGG + Intergenic
1098472306 12:70859474-70859496 GAGAAAAATGCTAATGAAGAAGG + Intronic
1099801775 12:87465960-87465982 GAGAAAAAAGCAAAGGAAACTGG + Intergenic
1100350457 12:93776488-93776510 AAGAAAAAGCCTTAGGAAACAGG - Intronic
1100362730 12:93893104-93893126 CAGAAAAACACAAAGGAAACTGG - Intronic
1100817125 12:98397280-98397302 CAGAAAAACCCTCAGGCAGCAGG + Intergenic
1100979292 12:100152247-100152269 CACAAAAAGGCTAAGGATGCTGG - Intergenic
1101094786 12:101326883-101326905 CAAAATAAGGCTAAGAGAGCTGG - Intronic
1101218953 12:102616689-102616711 CACAAAAAGGCAGAGGCAGCTGG - Intergenic
1101531155 12:105574791-105574813 TAGAATAAGGCTTAGGAACCTGG + Intergenic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1102581339 12:113890213-113890235 CAGAAAAATGCTAATGATTCTGG + Intronic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1103733372 12:123043182-123043204 GAGACTAAGGCTCAGGAAGCAGG + Intronic
1104107426 12:125676490-125676512 CAGCAGAAGGCTAGGGGAGCTGG + Intergenic
1104267065 12:127243737-127243759 CAAATAAAGACTAAAGAAGCAGG + Intergenic
1104343229 12:127971635-127971657 CTACAAAAGGCTAAGGAAACAGG + Intergenic
1106402676 13:29444890-29444912 CAGGCAAAGGCAAAGGAAGGAGG - Intronic
1107615871 13:42167529-42167551 AAGATAAAGGCAATGGAAGCAGG - Intronic
1108298781 13:49053244-49053266 CAGAAACATACTAAGAAAGCCGG - Intronic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1111305025 13:86399739-86399761 AACAAAAAGGCTAAGCAAGAAGG + Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1114842192 14:26277673-26277695 AAGAAAATAGCTTAGGAAGCAGG - Intergenic
1115338137 14:32262881-32262903 CTCAAAAAGGCTGGGGAAGCAGG - Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1118879535 14:69814446-69814468 TAGAAAAAGGCTAGGAAATCAGG + Intergenic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1118910095 14:70054683-70054705 AAGCAAAAAGCCAAGGAAGCTGG + Intronic
1119971790 14:78979044-78979066 AAGAAAAAGGCAGAGGAAGGAGG - Intronic
1120254958 14:82106842-82106864 CATAAAGAGGCTAGGGAAGCAGG - Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121227833 14:92334374-92334396 CAAACAAAGGCTGAGGAAGATGG + Intronic
1121330481 14:93046551-93046573 CAGAAAAAGGCTAGGTAAGCAGG + Intronic
1122534349 14:102451875-102451897 CTGGAGAAGGCTTAGGAAGCTGG - Intronic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1124434397 15:29635137-29635159 CATAAAAACCCTAAGGAGGCCGG - Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1127198925 15:56621835-56621857 GACAAAATGGCTTAGGAAGCAGG - Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1128997400 15:72306983-72307005 GAGAGGAAGGGTAAGGAAGCGGG + Intronic
1129054439 15:72808955-72808977 GAGAAACAGGGCAAGGAAGCAGG + Intergenic
1129419239 15:75410258-75410280 CAGAGAAATGCCAAGGAAGCTGG - Exonic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129754513 15:78089081-78089103 CACAAAAAGGCTAAGGATGCTGG - Intronic
1130316327 15:82800050-82800072 CAAATAAAGGCTGAGGAAGAGGG - Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1131878929 15:96841825-96841847 TTGAAAAGGGCTAATGAAGCTGG + Intergenic
1132318898 15:100910563-100910585 GAGAAAATGGCACAGGAAGCTGG + Intronic
1132984471 16:2757221-2757243 AAGAAAAAAGTTAAGCAAGCAGG - Intronic
1133414898 16:5598858-5598880 GAGAAAAAGGTTGGGGAAGCCGG - Intergenic
1134215578 16:12314468-12314490 CAGAGAAAGGCTAGGGAACTCGG - Intronic
1134303636 16:13013069-13013091 CAGTTAAAGGCCGAGGAAGCAGG + Intronic
1134859587 16:17549191-17549213 CAGAAAGAAGCAAAGGAAGGGGG - Intergenic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135731303 16:24897248-24897270 CTTAAAAAGGCAAAGGAGGCTGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138403846 16:56772190-56772212 CAGAAAAAGGATAAAGAACATGG + Intronic
1138673586 16:58634919-58634941 CGGAAGAAGGCTAAGGAAAGAGG - Intergenic
1139392624 16:66614519-66614541 CTGAAAATGGGTAAGAAAGCTGG + Intergenic
1140012974 16:71154675-71154697 CAGGAAAAAGGAAAGGAAGCAGG - Intronic
1140042520 16:71417957-71417979 CGGAAAAAGGCTAGGGACACAGG + Intergenic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1140555689 16:75918530-75918552 CAGAAAGAGCATAAGGAAACGGG + Intergenic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143077170 17:4354229-4354251 CAGAAAAAGTCAAGAGAAGCTGG - Intronic
1143572061 17:7765586-7765608 TAAACAAAGGCTAAAGAAGCGGG - Intronic
1145763166 17:27439350-27439372 CAGAGAAGGGATGAGGAAGCAGG - Intergenic
1145764992 17:27452574-27452596 CAGAAAAAGCCTCAAGAACCTGG + Intergenic
1146519910 17:33518346-33518368 CTGAAAAAGGCTAAGGTTGGTGG + Intronic
1147029700 17:37622592-37622614 CATAAAAAGGCTAAGAAACTCGG - Intronic
1148119137 17:45197513-45197535 CAGAAAAAGGCCCAGGCAGGGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150793470 17:68219259-68219281 TAGAAAAAGGCTGATGCAGCTGG - Intergenic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1150924145 17:69514988-69515010 CAGAAAAAGGCAAAGGAAAATGG - Intronic
1151361874 17:73593798-73593820 AAGAAGAGGGCTGAGGAAGCAGG - Intronic
1151623870 17:75264294-75264316 CAGAAGAAGGCGAAGGGAGGTGG - Intronic
1152426534 17:80221176-80221198 GAAAAAAAGGCAAAGGAAGTCGG + Intronic
1152487553 17:80604035-80604057 CAGAAGAGGGTTAAGAAAGCAGG - Intronic
1153401389 18:4687304-4687326 CAGAAAATGACTAGGGATGCTGG + Intergenic
1155160585 18:23192401-23192423 CAGAAGAAGGCTGAGGAATCTGG + Intronic
1155384689 18:25264835-25264857 CAGAAAAAGCTTCAGGAAGGAGG + Intronic
1155399129 18:25418748-25418770 CAGAAAACAGCTGAGGAAGCTGG + Intergenic
1155616877 18:27732045-27732067 CAGAAAAGGGCTGAAGAAGGCGG + Intergenic
1155809780 18:30217328-30217350 CAGCCAATGGCTAAGCAAGCAGG + Intergenic
1156310407 18:35917321-35917343 CAGTCACAAGCTAAGGAAGCAGG - Intergenic
1156697105 18:39780348-39780370 GAGAAAGAGGATATGGAAGCAGG - Intergenic
1156742146 18:40344173-40344195 TAGAAAAAGGCAAACAAAGCAGG - Intergenic
1157663725 18:49467981-49468003 GAGAAAAAGGCTAAGGAAAGCGG - Intergenic
1158978923 18:62739609-62739631 GAGAAAGAGGCTAAGGATGATGG + Intronic
1159042517 18:63338026-63338048 CATTAAAAGGCTCAGGAAGATGG - Intronic
1159673278 18:71250011-71250033 AAGAAACAGGATAGGGAAGCAGG - Intergenic
1159938459 18:74387214-74387236 CAGAAGAAAGCCAAGGCAGCTGG - Intergenic
1160087052 18:75786349-75786371 CTCAAAAAGGCAAAGGAAGGGGG - Intergenic
1160348938 18:78158283-78158305 CAGAAAAAGGCTTGGGAAAAAGG - Intergenic
1161285473 19:3466256-3466278 AAGTAAAAAGCAAAGGAAGCTGG - Intronic
1165422889 19:35731217-35731239 CAGTAACATGCTAGGGAAGCTGG + Intronic
1165823264 19:38690724-38690746 CAGAACAAGGCTAGGCAAGGTGG - Intronic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1167221728 19:48203819-48203841 AGGAACAAGGTTAAGGAAGCTGG - Intronic
925560637 2:5190235-5190257 CAGAAAGAGGCCAAGCATGCAGG - Intergenic
926676980 2:15633097-15633119 CAGAACAAGGCAGAGGAACCTGG + Intergenic
927102049 2:19795289-19795311 CAGCAAAAGGCAAAGGGAGATGG - Intergenic
927669514 2:25057337-25057359 CTGAAAATGGCAGAGGAAGCAGG - Intronic
927946338 2:27137365-27137387 GAGAAAAGGCCGAAGGAAGCAGG - Exonic
928649073 2:33386057-33386079 TAGACCAAGGCTAGGGAAGCGGG - Intronic
928726090 2:34175070-34175092 TAGAAAAAAGCAATGGAAGCAGG + Intergenic
930377466 2:50586107-50586129 CTGAAAAAGGCTAATGTAGATGG - Intronic
930545905 2:52766651-52766673 CAGAAGTAGGCTAAAGAAGATGG + Intergenic
932115383 2:69042077-69042099 AATAAAAAGTCTAAGGCAGCTGG + Intronic
932176561 2:69608174-69608196 CAAAAGAAGGCTAGGGCAGCAGG + Intronic
932744178 2:74317963-74317985 AAGAAAAAGTCCAAGGAAACAGG + Intronic
932896040 2:75640971-75640993 GAGAAAAATGCAAAGGAAGTTGG + Intergenic
934844784 2:97655791-97655813 CACAAAAAGCCTCAGGAGGCTGG - Intergenic
935130410 2:100257165-100257187 AATAAAAAGGCTGAGGAAGAGGG - Intergenic
935406013 2:102709429-102709451 CAGAAAAATTCTACTGAAGCAGG - Exonic
935548284 2:104423894-104423916 CAGAAAACGCATAAGGAAGAAGG - Intergenic
935987380 2:108688124-108688146 GAGGAAGAGGCTGAGGAAGCAGG - Intergenic
936126204 2:109790820-109790842 GAGGAAGAGGCTGAGGAAGCAGG - Intergenic
936218489 2:110580648-110580670 GAGGAAGAGGCTGAGGAAGCAGG + Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
936965505 2:118123993-118124015 CAGAGAAAGGCTCTGCAAGCTGG + Intergenic
937413278 2:121694982-121695004 CAGAAAAAGGCCAGGGACTCTGG + Intergenic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
938114700 2:128595155-128595177 CAGGAAAAGGCTAAAAAAGGAGG - Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940062812 2:149591397-149591419 CAGAAAAGTGCCAAAGAAGCTGG + Intergenic
940132280 2:150395988-150396010 CAGAAAAAAGCAAAGACAGCTGG - Intergenic
940862092 2:158781264-158781286 CAGAAAATAGCTATGGTAGCAGG - Intergenic
941219921 2:162765057-162765079 CAGGAGAAGGGTAAGGAAGGAGG + Intronic
941381954 2:164803955-164803977 CAGACACAGGCTAATGAAGAGGG + Intronic
943779932 2:191812330-191812352 CACAAAAAAGCCAATGAAGCGGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944598045 2:201280210-201280232 AAGATAAAGTCTAAGGAAGTAGG + Intronic
944946890 2:204698149-204698171 CAGAAAAACGCAATGGAAACAGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946447184 2:219750086-219750108 GAGAAAAAAGATAAGCAAGCAGG + Intergenic
948474158 2:238205831-238205853 TAGAAAAAGGTTAATTAAGCAGG + Intergenic
948564376 2:238874437-238874459 AAGAAAAATGTTAAGGATGCAGG + Intronic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
1168922368 20:1550964-1550986 AAGAAAAAGGCTTTGGATGCAGG + Intronic
1169193317 20:3670969-3670991 CAGGAGTAGGCTCAGGAAGCAGG + Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1170204586 20:13784733-13784755 CCGAAAAAGGCTCAGGAGGAAGG + Intronic
1171435081 20:25116073-25116095 CAGTAAAAGGCAAAGGCATCTGG - Intergenic
1172761607 20:37327354-37327376 CAGAAGAAGGCCAAAGAAGCTGG - Intergenic
1173278419 20:41604761-41604783 GGGAAGAAGGCTCAGGAAGCTGG + Intronic
1173729224 20:45317040-45317062 CAGCAAAGGGGCAAGGAAGCAGG - Exonic
1173764453 20:45595006-45595028 CAGAAGTAGGCTTAGGAAGATGG - Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176305687 21:5121967-5121989 CAGAAATAAGCATAGGAAGCAGG + Intronic
1176658889 21:9614799-9614821 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1176937991 21:14888890-14888912 CAGAAGCAAGGTAAGGAAGCGGG - Intergenic
1177521463 21:22233147-22233169 CACAAACAGACTAAGGAACCTGG + Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177681688 21:24379448-24379470 CAGAAAAAGGTTAAGGGAGAAGG - Intergenic
1178137442 21:29643043-29643065 CAGATAAGAGCTATGGAAGCAGG - Intronic
1178480739 21:32977587-32977609 GAGAGAAAGGCTAAGAAAGTTGG - Intergenic
1179259282 21:39744000-39744022 CAGAAAATGACTAGGGATGCTGG - Intergenic
1179851370 21:44140064-44140086 CAGAAATAAGCATAGGAAGCAGG - Intronic
1180152379 21:45956803-45956825 CAGAAAGTGGCCATGGAAGCAGG + Intergenic
1180229471 21:46418378-46418400 CAGAACCAGGCAAAGGATGCAGG - Intronic
1180600807 22:17014201-17014223 CAGAAAAAGGCCAGTGGAGCTGG - Intergenic
1181504829 22:23346121-23346143 AACAAAAAGGCTAAGTAAGAGGG - Intergenic
1181655940 22:24298723-24298745 AACAAAAAGGCTAAGTAAGAGGG - Intronic
1181709817 22:24676365-24676387 AACAAAAAGGCTAAGTAAGAGGG - Intergenic
1182146923 22:28002214-28002236 CAGAACAAGGCTAAGGGCGCGGG + Intronic
1182748851 22:32626026-32626048 CAGGAAAAGCTTAAGGAAGGAGG + Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1185166991 22:49267309-49267331 GAGACAGAGGTTAAGGAAGCTGG + Intergenic
1185413976 22:50699825-50699847 CAGAACAAGGCCAAGGAAGGAGG - Intergenic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949576118 3:5340570-5340592 GAGAAAAAGGCCAAGGAACCAGG - Intergenic
950727147 3:14923827-14923849 CAGACAAAGGCTATGGGGGCTGG - Intronic
951002520 3:17580372-17580394 CAGAAGAAGCCTAAAGAAGTGGG + Intronic
951092533 3:18591266-18591288 CAGGAAAAAGCTGAGGGAGCAGG + Intergenic
951202208 3:19888237-19888259 CAGCAAATGGCTAAGCATGCTGG + Intronic
952377458 3:32779688-32779710 AAGAAAAAGGCTAAGTAGGAAGG - Intergenic
953094487 3:39761544-39761566 CAGAAAAGGGCTAAGGAAGGCGG + Intergenic
953243629 3:41171039-41171061 AAAAAAAAGGCCAAGGAAACAGG + Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953646688 3:44761899-44761921 CAAAAATAGGGTAACGAAGCCGG - Intronic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
955354282 3:58217575-58217597 CTGAAAAAGGCTATGGATCCAGG - Intergenic
956000670 3:64726797-64726819 CAGAAAACTTCTAAAGAAGCTGG - Intergenic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
957156432 3:76550815-76550837 CTGAAGAAGGCTGAGGCAGCAGG - Intronic
957506250 3:81125174-81125196 CAGGAAAAGGGTAAGCAAGAGGG + Intergenic
959005345 3:101013492-101013514 CTGAAAAAAGGTAAGGAAACAGG - Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960395194 3:117129180-117129202 CAGAACAGGGCTAAATAAGCAGG - Intronic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961545717 3:127631436-127631458 CAGAAGGAGGCAAAGGAAGCAGG - Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
963125010 3:141807898-141807920 CAGAGCAACGCTTAGGAAGCAGG + Exonic
963188904 3:142447685-142447707 CCGAAAGGGGCTAAGGACGCAGG - Intronic
963472745 3:145763270-145763292 CAGAAAACAGGTAAGAAAGCAGG + Intergenic
963659178 3:148102908-148102930 CAGAAAAAAGGAAAGGAAGAAGG - Intergenic
963788747 3:149561825-149561847 TAGAATAATGCTCAGGAAGCTGG + Intronic
964047590 3:152348916-152348938 GAGAAAAAGGTTGGGGAAGCAGG + Intronic
964113390 3:153110454-153110476 AAGAAAAAGTATAAAGAAGCTGG - Intergenic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
964951087 3:162294126-162294148 CAGAAAAAAGCTAACACAGCAGG - Intergenic
965327813 3:167329520-167329542 CAGAAAAAGGTGCAAGAAGCAGG + Intronic
965629065 3:170711975-170711997 ATGCAAAAGGCAAAGGAAGCAGG + Intronic
966220309 3:177544906-177544928 CAGAAAAAGACCAAGCAAACAGG - Intergenic
966832942 3:184026412-184026434 GACAAAAAGGCTGCGGAAGCTGG - Intergenic
966965834 3:184992210-184992232 GGAAAAAAGGCTATGGAAGCAGG - Intronic
967101501 3:186219746-186219768 AAAAAAAAGGCTGAGGAAGGAGG + Intronic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967867087 3:194198997-194199019 CAGAAAGAGGCTATGGAGGAGGG - Intergenic
968441562 4:626969-626991 CAGAAAAGGGGAGAGGAAGCTGG - Intronic
968915286 4:3494572-3494594 GAGATAAAGGCCAGGGAAGCCGG - Intronic
969038723 4:4276965-4276987 CAGAAATAGACTTAGGAAGAAGG + Intronic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
970351949 4:15210144-15210166 CAGAAAAAGGTCAAGCAAGTGGG + Intergenic
970603403 4:17658133-17658155 TAGTAAATGGCAAAGGAAGCGGG - Intronic
972389289 4:38598196-38598218 TATAAGAAGGTTAAGGAAGCTGG + Intergenic
972901223 4:43686183-43686205 CAGAAAAAATCTGAGTAAGCAGG - Intergenic
973553912 4:52062752-52062774 CAGCAAAAGTCAAATGAAGCAGG + Intronic
974073382 4:57146283-57146305 GAGAGAAAGGGTAAGGAAGGAGG - Intergenic
974768171 4:66375671-66375693 CAAAGAAACGCTTAGGAAGCAGG - Intergenic
974803602 4:66851621-66851643 AAGTAAAAGGCCAAGGATGCAGG + Intergenic
975082327 4:70296245-70296267 TAGAAAAAAGTAAAGGAAGCAGG - Intergenic
976072682 4:81259717-81259739 AAGAAAAAGACTAGGAAAGCAGG - Intergenic
976180418 4:82393687-82393709 CAGCTAAAGGCTCAGGAAGATGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978007544 4:103636353-103636375 CAGAAAAAAACTCATGAAGCTGG - Intronic
978363036 4:107951003-107951025 CAGAACAAGCCCAAAGAAGCTGG - Exonic
978488539 4:109284688-109284710 CACATGAAGGCAAAGGAAGCTGG + Intronic
979647629 4:123090012-123090034 GAGAAACAGGCAAAGAAAGCAGG - Intronic
981153667 4:141408791-141408813 GAGAAAAAGGCTGAGTAAGAGGG + Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982816055 4:159886206-159886228 CAAAATGAGGTTAAGGAAGCAGG - Intergenic
983280752 4:165678221-165678243 GAACAAAAGGCTAAGGAACCTGG - Intergenic
984540796 4:181034682-181034704 CAGAGACAAGGTAAGGAAGCAGG - Intergenic
984599195 4:181706654-181706676 AACAAACAGGCGAAGGAAGCTGG + Intergenic
985416436 4:189740629-189740651 CAGAGAAAGGTTAAGGACACAGG + Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986892005 5:12320524-12320546 CAGAAACAGGTTAAGGACCCAGG + Intergenic
987569011 5:19630889-19630911 CAAATAATGGCTAAGGAAGAAGG + Intronic
988785119 5:34559731-34559753 CAAAAAAAAGCAAAAGAAGCTGG - Intergenic
990420236 5:55624855-55624877 GAGAAAAAGATTAAGGAATCTGG - Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
991494280 5:67212227-67212249 AAGAAAAAGGCCAAGTAAGAGGG - Intergenic
992026109 5:72670284-72670306 CAGGACAAGGCTAAAGAAGGTGG - Intergenic
992096770 5:73370087-73370109 CAGAAATATGTGAAGGAAGCTGG + Intergenic
992168649 5:74080002-74080024 CAGAACAAAGCTAAGGAAAATGG + Intergenic
992689398 5:79228322-79228344 GAGTAAAAGGCTCAGGAAGTGGG + Intronic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
997211928 5:132081899-132081921 AAGAAATACGCTAAGGCAGCAGG + Intergenic
997727744 5:136136098-136136120 AAGAAAAGGCCCAAGGAAGCTGG + Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997850577 5:137329148-137329170 AACAAAAAGGCTAGGGAAGAGGG + Intronic
998234450 5:140386144-140386166 AAGAAAATGGCAGAGGAAGCCGG - Intergenic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000814175 5:165899754-165899776 CAGCATAAAGCCAAGGAAGCTGG + Intergenic
1002701331 5:181127315-181127337 CAGACCAAGGCCAATGAAGCAGG - Intergenic
1003992291 6:11498237-11498259 CACAAAAAGGCTAGAGATGCAGG - Intergenic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004533687 6:16478536-16478558 AAGGAAAAGGCAAAGGAAACCGG + Intronic
1005138809 6:22602662-22602684 CAGAAAAGGACTCAGGATGCAGG - Intergenic
1005200790 6:23341904-23341926 TTGAAAAAGGCTAAAGAAGTGGG + Intergenic
1005332117 6:24760704-24760726 CAGAAAAAGGCTGAAGAGGTGGG - Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1006105490 6:31713816-31713838 CAGACACAGGCTCAGGAATCTGG + Exonic
1006146021 6:31960217-31960239 CAGAAAATGGCAGAGGAAGACGG + Exonic
1006922638 6:37636700-37636722 CAGAAATAGGTCAAGGAATCTGG + Exonic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1010477434 6:76305594-76305616 CAGCAAAGGGTTGAGGAAGCTGG - Intergenic
1010801411 6:80179854-80179876 CAGATAGAGGCAAAGGCAGCTGG + Intronic
1011443267 6:87409507-87409529 AAAAAAAAGGCTAAGCAGGCTGG - Intronic
1012352980 6:98276489-98276511 CAGTAAAAGCCCAAGGAAGGGGG - Intergenic
1012833891 6:104241005-104241027 CAGAAAAAGGTTAACATAGCAGG + Intergenic
1013620528 6:111883957-111883979 CAGCAGAAGGCAGAGGAAGCCGG + Intergenic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1014872491 6:126614030-126614052 CAGAAATAGGCTTTGGAAGGTGG - Intergenic
1015434053 6:133165569-133165591 CAGAATAAGGCCAAGGCAGGAGG + Intergenic
1016625295 6:146159804-146159826 CAGAACAAGGCTCAGGAGGGAGG + Intronic
1017477829 6:154816228-154816250 AAGAAAAAGGCAAAAGAAACTGG - Intronic
1018050624 6:160005548-160005570 CAGAAAAAGGCCCTGGAAGCGGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1020299305 7:6782883-6782905 CAAAAAAAAACTAAGGAAGTGGG + Intronic
1020421759 7:8014291-8014313 AAGAAAGAGGCCAAGGCAGCCGG - Intronic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1021784814 7:24141226-24141248 AAGAAAAGGGCTAATGAAACTGG + Intergenic
1023002308 7:35822788-35822810 CAGTAAAACTGTAAGGAAGCAGG - Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024975615 7:55111419-55111441 CACAAACAGGCTCAGGAAACTGG - Intronic
1025887012 7:65605489-65605511 CAGAAAAAGGCAAAGTATCCTGG - Intergenic
1026379371 7:69783749-69783771 CAGAAACAGGCAAAGGAAGGGGG - Intronic
1028533124 7:91861274-91861296 CAAAAAAAGTTTAAGGAAGGTGG + Intronic
1028632994 7:92956134-92956156 CAAAAAAAGACTGGGGAAGCTGG - Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1030440514 7:109583589-109583611 CAGACACAGGCTAAAGAAGCTGG + Intergenic
1031154089 7:118088406-118088428 CAGAAAAAAGCAAAGGATGATGG - Intergenic
1031252076 7:119397310-119397332 CTGTAAAAGGCTCAGGAAGTGGG - Intergenic
1031932537 7:127700720-127700742 CAGAACAAGGCTGAGGAATGTGG - Intronic
1031935429 7:127731118-127731140 CAGAAAGAGCCTAAGGGAGACGG - Intronic
1032660506 7:133978760-133978782 CAGAAAGATGCTCAGGCAGCTGG - Intronic
1033494934 7:141884511-141884533 CAGAAAAACCCTAGGGATGCAGG - Intergenic
1033513436 7:142083269-142083291 AAGAAAAATGCTAATCAAGCTGG - Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034408274 7:150921130-150921152 GAGAAAAAGGCTAAGATAGATGG + Intergenic
1035109980 7:156473367-156473389 CAGAAAAACTGTAAGGAAGGTGG + Intergenic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037103045 8:15071790-15071812 CAAAAAAAAGCTTAGGAAGATGG + Intronic
1037575827 8:20201722-20201744 CAGAAAATGGCTAAGACAGTAGG - Intronic
1038798743 8:30731005-30731027 CACAAAAAGGCAAGGGAAGGGGG + Intergenic
1042296490 8:67223690-67223712 CAACAGAAGGCTAAGAAAGCAGG + Intronic
1043575873 8:81655588-81655610 AAGAAAGAGACTAAGGAAGGGGG + Intergenic
1044016375 8:87052259-87052281 CAGAAGGAAGCTATGGAAGCAGG - Intronic
1044326744 8:90867866-90867888 CAGAAAAAGGGTGAGAAAGGGGG - Intronic
1044483763 8:92725017-92725039 GAGAAAAAAGCTTAGAAAGCAGG - Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1045415483 8:101962486-101962508 GAGAAAAGGGTAAAGGAAGCAGG - Intronic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045782109 8:105878691-105878713 CAGAAAAAGGCTAAATTATCTGG + Intergenic
1045800460 8:106095590-106095612 GAGAAGAAGGCTAATGAAGCTGG - Intergenic
1046375486 8:113374415-113374437 TAGAAAAAATTTAAGGAAGCTGG - Intronic
1046611236 8:116427938-116427960 CAGAAAAGAGCTAAGGGAGAAGG + Intergenic
1047191719 8:122684419-122684441 CAGAAAAAGCCTGAAGAGGCTGG + Intergenic
1047421046 8:124708509-124708531 CAGACCAAGGCAAAGGCAGCTGG + Intronic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047962166 8:130018284-130018306 CAGGAAAAGGGTTTGGAAGCAGG + Intergenic
1048969320 8:139635716-139635738 CAAAAGAAAGCTAAAGAAGCAGG + Intronic
1050093359 9:2038548-2038570 CAGGAAAGGGGTAAAGAAGCTGG - Intronic
1050620409 9:7446517-7446539 GAGAAAAAGACTAATAAAGCTGG - Intergenic
1051064955 9:13092211-13092233 CAGACAAAGGCTTGGCAAGCAGG + Intergenic
1052819998 9:33130878-33130900 CAGAAGCAGGCAGAGGAAGCAGG + Intronic
1056023159 9:82462874-82462896 AAGAAACAGGCTTAGGAAGCTGG + Intergenic
1056306372 9:85294737-85294759 CAGGAAAAGTCTAAGGCAGGAGG - Intergenic
1057485897 9:95483921-95483943 CAGAAAAAGGCTTTGAAACCTGG + Intronic
1058186075 9:101856682-101856704 CAGAAAGAGGCCAAGGAATCGGG - Intergenic
1058379080 9:104358945-104358967 CAGCAAATGGCTAAGGAACATGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059433178 9:114261840-114261862 CAGAAACAGGCTCAGGATGGTGG - Intronic
1059653071 9:116333565-116333587 CAGATAAAAGCCAAGGGAGCAGG + Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061375763 9:130223370-130223392 AAAAAAAAGGCTAAGGACTCTGG - Intronic
1062002555 9:134224049-134224071 CAGAAAAAGGTTCAGTAAACTGG - Intergenic
1062730822 9:138107474-138107496 CAGAAATGGGATAAGGAAGGAGG - Intronic
1203636635 Un_KI270750v1:118406-118428 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1186352625 X:8755965-8755987 CACAAAAATGCTAAGGATGAAGG + Intergenic
1187000242 X:15169275-15169297 CAGAGAAAGGCAAAGAAAGATGG - Intergenic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1187896275 X:23982425-23982447 CAGTAAAAGGCTGCGGAGGCGGG + Intergenic
1188314591 X:28657655-28657677 CATAAAAAGGCTAAGAATTCTGG + Intronic
1189569522 X:42280993-42281015 CATTAAAAGGCCAAGAAAGCTGG - Intergenic
1190971930 X:55357644-55357666 CAGAAAAAGGCTCCAGAAGATGG + Intergenic
1191680657 X:63836754-63836776 CAAAAATAGGCTAAGACAGCTGG + Intergenic
1192082223 X:68059464-68059486 TAAATAATGGCTAAGGAAGCAGG - Intronic
1193288425 X:79741414-79741436 TAGAGAAAGGCAAAGGAAACAGG - Intergenic
1197198135 X:123724386-123724408 AATAAAAAGGCAATGGAAGCCGG + Intronic
1197360569 X:125497541-125497563 CACAAAAAGGCTAAATAAGAAGG + Intergenic
1198327782 X:135591381-135591403 CAGAAAAAGGCTAGGCAGGGCGG + Intergenic
1199803941 X:151279351-151279373 CAGAGAAAGGCAAAGGAATGGGG - Intergenic