ID: 953606924

View in Genome Browser
Species Human (GRCh38)
Location 3:44418375-44418397
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953606924_953606926 9 Left 953606924 3:44418375-44418397 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 953606926 3:44418407-44418429 TCTTTTAAATTACCCAGTCTTGG 0: 5
1: 64
2: 562
3: 5885
4: 6488
953606924_953606927 10 Left 953606924 3:44418375-44418397 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 953606927 3:44418408-44418430 CTTTTAAATTACCCAGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953606924 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr