ID: 953607592

View in Genome Browser
Species Human (GRCh38)
Location 3:44421649-44421671
Sequence GCACACTCCTGGGCTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953607581_953607592 18 Left 953607581 3:44421608-44421630 CCTCTGTGCAGGCGGGCCCTGGG 0: 1
1: 0
2: 3
3: 34
4: 272
Right 953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG 0: 1
1: 0
2: 0
3: 11
4: 161
953607585_953607592 2 Left 953607585 3:44421624-44421646 CCCTGGGGACTGCAAGGAGCCTC 0: 1
1: 0
2: 2
3: 30
4: 215
Right 953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG 0: 1
1: 0
2: 0
3: 11
4: 161
953607586_953607592 1 Left 953607586 3:44421625-44421647 CCTGGGGACTGCAAGGAGCCTCC 0: 1
1: 0
2: 1
3: 18
4: 223
Right 953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953607592 Original CRISPR GCACACTCCTGGGCTGAAAT GGG Intergenic
903437330 1:23360527-23360549 TGACACTACTGGGCTTAAATTGG + Exonic
904370857 1:30046570-30046592 TCACACTCCTTGGCTGTAATAGG - Intergenic
905920279 1:41714642-41714664 TCACACTCTGGGGCTGACATGGG + Intronic
906103101 1:43275570-43275592 ACCCACTCCTGGCCTGATATGGG + Intergenic
906273312 1:44498310-44498332 GTACACTCTTGGGCAGAATTGGG - Intronic
906723449 1:48025972-48025994 GCTCAGTCCTAGGCAGAAATTGG + Intergenic
906809377 1:48810593-48810615 GCATAGTCCTGGGCATAAATAGG + Intronic
910038355 1:82816747-82816769 GCAGAGTCCAGGGCTGAATTTGG + Intergenic
910460143 1:87440268-87440290 CCATACTCCTGGACTGAAAGGGG - Intergenic
913247540 1:116883436-116883458 GCACTCTGCAGGGCTGAAGTGGG + Intergenic
915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG + Intergenic
916520364 1:165557978-165558000 GCACAGCCCTGGGCAGAACTGGG + Intronic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
919605186 1:199673159-199673181 GCACACTGCTGGCATGTAATAGG - Intergenic
921187040 1:212679051-212679073 GCACAGCCCTGGGGTGAAATGGG + Intergenic
924206007 1:241712050-241712072 ACACACTCTTGGGCTGAAGAAGG - Intronic
1063381448 10:5588686-5588708 CCACCCTCCTGGGCTGACAGTGG - Intergenic
1063522698 10:6755223-6755245 ACTCACTCCTGGGCTGACAAAGG + Intergenic
1064191139 10:13207031-13207053 TCAAACTCCTGGGCTCAAGTGGG + Intronic
1068775810 10:60866650-60866672 GCCCACTTCTGGGCTGAGCTTGG - Intergenic
1068915703 10:62428944-62428966 GCACACTGATAGCCTGAAATTGG - Intronic
1070981282 10:80650194-80650216 CAACACGCCTGGTCTGAAATGGG + Intergenic
1071387751 10:85139516-85139538 GCCCACACCTTGGCTGTAATTGG - Intergenic
1073455948 10:103636829-103636851 GCTCAATCCTGGGCTGAACAGGG - Intronic
1079996952 11:27305041-27305063 GCAGGCTCCTGGGCTGAAAGGGG + Intergenic
1082167369 11:48964533-48964555 GGTCACTCCTGGTCTGACATTGG - Intergenic
1082236211 11:49822165-49822187 GGTCACTCCTGGTCTGACATTGG + Intergenic
1082239658 11:49856673-49856695 GGTCACTCCTGGTCTGACATTGG + Intergenic
1082242496 11:49887678-49887700 GGTCACTCCTGGTCTGACATTGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1088328838 11:108629216-108629238 GCAGGCTCCTGGGCAGAAAGGGG - Intergenic
1090597461 11:128334993-128335015 GCAAACTGCGAGGCTGAAATAGG - Intergenic
1092508082 12:9124795-9124817 GCAGACTCCTGGGCAGAAGGGGG + Intergenic
1092763229 12:11828341-11828363 GCACAGTCCTGACCTTAAATAGG - Intronic
1096136387 12:49205299-49205321 TCACACTGGTGGCCTGAAATGGG + Intronic
1099295408 12:80822826-80822848 GCAGACTCCTGGGTGGAAAGGGG + Intronic
1100997311 12:100316320-100316342 TCACACACCTGGGTTGAATTGGG + Intronic
1102512186 12:113422996-113423018 GCAGCCACCAGGGCTGAAATGGG - Intronic
1102620974 12:114194178-114194200 ACACACCCCTAGGCTGAAAGGGG + Intergenic
1106419705 13:29576039-29576061 GCACTCTCGGAGGCTGAAATAGG + Intronic
1107757034 13:43635786-43635808 GCACACACATGCACTGAAATGGG + Intronic
1112251811 13:97788290-97788312 GCACACACTGGGTCTGAAATAGG - Intergenic
1114715056 14:24816160-24816182 GCAGAGTCCTGAGCTGAAAATGG - Intronic
1115711148 14:36052425-36052447 GAACACTCCAGTACTGAAATGGG + Intergenic
1116151279 14:41145364-41145386 GCAGTCTCCTGAGCGGAAATGGG - Intergenic
1116159763 14:41253612-41253634 GCAGGCTCCTGGGCAGAAAGGGG - Intergenic
1116493322 14:45531983-45532005 GGACACACATGGGCTGAAAGTGG - Intergenic
1117201434 14:53393843-53393865 GCCCAATCCTGGGGAGAAATTGG - Intergenic
1118722159 14:68602038-68602060 GCCCATCCCTGGGCAGAAATGGG + Intronic
1119204440 14:72783709-72783731 GCACATTCCAGGCCTGATATTGG + Intronic
1126506086 15:49406268-49406290 GCACACTCGTTGGCTGAAGCAGG + Intronic
1130370352 15:83281119-83281141 CCACCCTCTTCGGCTGAAATAGG + Intronic
1132633424 16:930811-930833 GCAGACTGCTGGGCTGAGAATGG + Intronic
1133297457 16:4761924-4761946 CCACACCGCTGGGCTGGAATGGG - Intronic
1135498837 16:22976191-22976213 GCACAGTCATGAGCTGAATTTGG - Intergenic
1137508735 16:49079675-49079697 ACACACTCCTGGACTGTGATGGG + Intergenic
1137673986 16:50294797-50294819 GGACACCCCTGGGGTGTAATAGG - Intronic
1138389449 16:56659371-56659393 GCAGACTCCTGGGCTCTAAATGG + Intronic
1139705653 16:68738482-68738504 CCACACCCCTGGGTTGCAATGGG + Intronic
1140796752 16:78445515-78445537 GCTCCTTCCTGGGCTGAAGTCGG - Intronic
1141818490 16:86429286-86429308 GCAGACTCCAGGCCTGAAATGGG - Intergenic
1143786288 17:9258229-9258251 GCAGACTCCTGAGCTGAGGTGGG + Intronic
1143860576 17:9887684-9887706 GCAAACACCTAGGCTGATATAGG + Intronic
1147331887 17:39704246-39704268 GGACACTCCTGGGTAGAATTAGG + Intronic
1148227750 17:45910799-45910821 GCCCCCTTCTGGGCTGAACTGGG + Intronic
1148683957 17:49490399-49490421 GCTGACTCCTGGGCTGCAAGGGG - Intergenic
1148747590 17:49927277-49927299 GCACACACCTGGGCACACATAGG - Intergenic
1149938719 17:60838900-60838922 TCAAACTCCTGGCTTGAAATGGG + Intronic
1151560958 17:74869292-74869314 GCACATTCCTGGGCCTAACTTGG - Intronic
1156305484 18:35874785-35874807 CCACACCCCTGGGCTAATATTGG - Intergenic
1160211544 18:76884643-76884665 GTACTCTACTGGGCTGTAATTGG + Intronic
1160665876 19:327910-327932 TCACTCTCCCGGTCTGAAATGGG + Exonic
1166055122 19:40284018-40284040 GTTCACTCGTGGGCTGAACTTGG - Intronic
1166925675 19:46265468-46265490 CCACCCTGCTGGGCTGAAATAGG - Intergenic
1168469362 19:56628087-56628109 GCAGATTCCTGGGCTGAGAATGG + Intergenic
925768126 2:7257586-7257608 GCACCCCCCTGGGCTGAAGCAGG - Intergenic
927131702 2:20065689-20065711 GCAGAGTCCTGGGCTGAAAAGGG + Intergenic
930186654 2:48418406-48418428 CCACACTCATGGCTTGAAATAGG + Intergenic
933893015 2:86788687-86788709 GAACGATCATGGGCTGAAATTGG + Intronic
934096241 2:88608285-88608307 TCAAACTCCTGGGCTCAACTGGG + Intronic
937404954 2:121618495-121618517 CCTCACTCCTGGGATGAAAGGGG + Intronic
938036571 2:128039690-128039712 ACACACAGCTGGGCTGAAGTGGG - Intergenic
942585088 2:177466479-177466501 ACAGGCTCCTGGGCGGAAATGGG - Intronic
943129326 2:183837645-183837667 GCAGGCTCCTGGGCAGAAAAGGG + Intergenic
945330139 2:208529937-208529959 ACAGACTCCTGGGCAGAAAAGGG - Intronic
947701999 2:232242377-232242399 GCAAAGGCCTGGGCTGAAAGGGG + Intronic
948404738 2:237708777-237708799 GCGCACTCCTGGCCTGACCTTGG - Intronic
1173892492 20:46523686-46523708 GCACTCTCTTGGGATGAAACAGG - Intergenic
1174577918 20:51550208-51550230 TCAAGCTCCTGGGCTCAAATGGG - Intronic
1175315304 20:58043212-58043234 CCACACCCCAGGGCAGAAATAGG + Intergenic
1178356984 21:31917752-31917774 ACACACCCCTGGACTGAATTGGG + Intronic
1179424889 21:41268113-41268135 GTACAGTCCTGGGCTAAGATCGG - Intronic
1182051499 22:27315981-27316003 GCACTGTCCTAGGCTGAAATGGG - Intergenic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
1183473581 22:38023127-38023149 GAAGACTCCTGGGCTGTGATAGG + Intronic
950467534 3:13163959-13163981 GCACACGCCAGGGCTGAAGGGGG + Intergenic
952312951 3:32206853-32206875 GTACACTCCTGGGAAGAACTTGG - Intergenic
952419476 3:33118372-33118394 TCACACTCCTGGCCAGAAAAAGG - Intronic
953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG + Intergenic
954662404 3:52233079-52233101 GCTAGCTCCTTGGCTGAAATGGG + Intronic
954933090 3:54301169-54301191 TCAAACTCCTGGGCTCAAGTGGG - Intronic
954997566 3:54895619-54895641 GCAAACTGCTGGGTTGAAAGTGG + Intronic
957665352 3:83218594-83218616 GCAGGCTCCTGGGCGGAAAGGGG - Intergenic
960272805 3:115693086-115693108 GCCCTCTGCTGGGATGAAATGGG + Intronic
961654681 3:128434750-128434772 TCACACAGCTGGGCTGAGATTGG - Intergenic
962791295 3:138813933-138813955 GAATACACCTGGGCTGAAAAAGG + Intronic
963256413 3:143148940-143148962 GCACACTGCTGGCATGAAGTAGG + Intergenic
969619505 4:8272059-8272081 GCACACAGCTGGGCTGCAACGGG - Intronic
969619936 4:8273837-8273859 CCACACAGCTGGGCTGCAATGGG - Intronic
969847587 4:9931364-9931386 GCAAACTCCTGGGCTGGGAGAGG + Intronic
970492127 4:16585237-16585259 CCACACTCCTGGGCTGACTTTGG + Intronic
971152572 4:24049456-24049478 ATACACTCCTGGGGTGAATTGGG + Intergenic
971917929 4:32898198-32898220 TCAAACTCCTGGGCTTAAGTGGG + Intergenic
979461884 4:120993104-120993126 GCACACTGCTGGGCTGGACATGG - Intergenic
979472788 4:121121328-121121350 GGACACTCCTTTGCTGGAATTGG - Intergenic
981226367 4:142299242-142299264 TCACCCTCCTGGGCTCAAAAAGG + Intronic
982068586 4:151675437-151675459 GCACAATCCTCGTCTTAAATAGG - Intronic
982856248 4:160385781-160385803 ACAGGCTCCTGGGCAGAAATGGG - Intergenic
984486847 4:180381619-180381641 TCAAACTCCTGGGCTCAAGTGGG + Intergenic
985315686 4:188656968-188656990 TCAAACTCCTGGGCTCAAGTGGG + Intergenic
987308989 5:16664711-16664733 GCACACTTTGGGGCTGACATAGG + Intronic
988540774 5:32106854-32106876 GCCCACTACAGGGCTGATATTGG + Intronic
990402300 5:55451197-55451219 TCAAACTCCTGGGCTCAAGTGGG - Intronic
990448348 5:55913799-55913821 GCACTCTCCTGGCCTCAAAAAGG - Intronic
991528496 5:67590736-67590758 GCACAATCCTGAGATGAACTGGG + Intergenic
992481773 5:77158685-77158707 GCACGTTCCTAGGTTGAAATAGG + Intergenic
992729805 5:79651864-79651886 GTATACTCCTAGGGTGAAATTGG + Intronic
993545822 5:89211813-89211835 GCAGCCTCATTGGCTGAAATGGG + Intergenic
995528241 5:113067822-113067844 GCATTCTCCTGGGCTGACAGTGG - Intronic
997337853 5:133120470-133120492 GCACTTTCCTGGGCTGTAACAGG - Intergenic
999232107 5:150067752-150067774 GGACACCCCTGGGCTGAGACAGG + Intronic
1004249604 6:14012715-14012737 GCAGACTCCAGGGCCCAAATTGG + Intergenic
1005665791 6:28052979-28053001 TCAAACTCCAGGGCTGAAAAAGG - Intergenic
1005720843 6:28600545-28600567 GCAATCTCCTGGGCTCAAACAGG - Intronic
1006074118 6:31518730-31518752 TCAAACTCCTGGGCTTAAATTGG - Intergenic
1008641377 6:53466022-53466044 GCAAAGTCCTGGGCTGCAAGTGG - Intergenic
1011266950 6:85531804-85531826 TCAAACTCCTGGGCTCAAAGCGG - Intronic
1013354553 6:109335504-109335526 GCACACCCCTGGCCTGGAAGTGG + Intergenic
1018395379 6:163374196-163374218 GCACAGTTCTGGGCTGGAAGGGG + Intergenic
1024915240 7:54491924-54491946 GCACTCTCCGGAGCTGATATAGG - Intergenic
1025212479 7:57027989-57028011 GCACACTTCGGGGCTGTAACAGG - Intergenic
1025659476 7:63548838-63548860 GCACACTTCGGGGCTGTAACAGG + Intergenic
1026967199 7:74447840-74447862 ACACACTCCTGGGCTGCTGTGGG + Intergenic
1029675616 7:102066436-102066458 GCACACTTCGGGGCTATAATGGG - Intronic
1030099469 7:105932876-105932898 GCACGCTTTTAGGCTGAAATGGG - Intronic
1032695407 7:134331559-134331581 GGACACACCTGGGCAGAATTTGG - Intergenic
1033142571 7:138840649-138840671 GCACAGCCCTGGGTGGAAATGGG - Intronic
1034055539 7:148031233-148031255 AAACACTCCTGGGCTGTAAAAGG + Intronic
1035062862 7:156082137-156082159 GAACAGTCCTGGGATGAGATGGG - Intergenic
1039408992 8:37336192-37336214 CCACACTCCTGGCCTGCAACAGG + Intergenic
1044216309 8:89615086-89615108 ACAAACTCCTGGCCTGAATTTGG + Intergenic
1048062723 8:130937097-130937119 GCCCACTGCTGTGTTGAAATGGG - Exonic
1048257428 8:132915576-132915598 GGACACACCTGGGCTGGAACAGG + Intronic
1048977375 8:139680471-139680493 GCACAGTCCTGGGCTGGAGGAGG + Intronic
1049033325 8:140053317-140053339 GCACACTCCTGGACAACAATTGG - Intronic
1049224808 8:141445099-141445121 GCACAGTCCTGGGCTCTGATTGG - Intergenic
1051561310 9:18443665-18443687 GTACACACCTAGGCTGAAAAAGG - Intergenic
1055694028 9:78863670-78863692 GCAAGTTCCTTGGCTGAAATGGG - Intergenic
1056713748 9:89011902-89011924 GCACACCCCAAGGCAGAAATGGG + Intergenic
1057307940 9:93923199-93923221 GCAGACTCCTCCGCTGATATGGG + Intergenic
1059146300 9:111903022-111903044 GCACTTTGCTGGGCTGAGATGGG - Intronic
1060089914 9:120733512-120733534 ACTCACTTCTGGTCTGAAATAGG - Intergenic
1060933736 9:127504386-127504408 ACACCCTCCTGGGCTCAACTTGG + Intergenic
1061051615 9:128199617-128199639 TCAAACTCCTGGGCTCAAGTAGG - Intronic
1187628953 X:21146638-21146660 GCACCTTCCTCGGTTGAAATAGG - Intergenic
1193644747 X:84053807-84053829 ACACACTTCTGGACTGGAATAGG - Intergenic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1200006894 X:153091950-153091972 GCATACTCCAGGGCTGCCATGGG + Intergenic
1201393475 Y:13523248-13523270 GTACACATCTGGGCAGAAATGGG - Intergenic
1202242444 Y:22785625-22785647 TGACACTCCTGGGCTGACATTGG + Intergenic
1202395429 Y:24419374-24419396 TGGCACTCCTGGGCTGACATTGG + Intergenic
1202475355 Y:25250718-25250740 TGGCACTCCTGGGCTGACATTGG - Intergenic