ID: 953607950

View in Genome Browser
Species Human (GRCh38)
Location 3:44424174-44424196
Sequence CAGGCACACTTCCAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953607950_953607954 -2 Left 953607950 3:44424174-44424196 CCCCAAAACTGGAAGTGTGCCTG No data
Right 953607954 3:44424195-44424217 TGCCATTGCCTTTCCCTGCCTGG No data
953607950_953607960 21 Left 953607950 3:44424174-44424196 CCCCAAAACTGGAAGTGTGCCTG No data
Right 953607960 3:44424218-44424240 TTTCCAGCAGTCCCATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953607950 Original CRISPR CAGGCACACTTCCAGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr