ID: 953610307

View in Genome Browser
Species Human (GRCh38)
Location 3:44442460-44442482
Sequence TCCACGCACTTACCCACACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953610307 Original CRISPR TCCACGCACTTACCCACACT TGG Exonic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900508171 1:3040361-3040383 TCCACACACTCACCAACACTTGG + Intergenic
902743461 1:18456887-18456909 TCCACGTCCTCACCAACACTTGG + Intergenic
902956305 1:19926206-19926228 TCAAGGCACTTACTCCCACTGGG + Intergenic
903256607 1:22106464-22106486 TCCACTGACTTACCCATTCTGGG - Intergenic
906546187 1:46620969-46620991 TTCAGGCACTTATACACACTAGG - Intergenic
911325552 1:96467468-96467490 TCCATGCTCTTTCCCATACTAGG - Intergenic
911330345 1:96519395-96519417 TCAACCCACTTACCCTCTCTGGG + Intergenic
920212240 1:204336587-204336609 TGCACGCACATACATACACTGGG + Intronic
921776789 1:219110823-219110845 TCCACGTCCTTACCAATACTTGG - Intergenic
923452370 1:234130672-234130694 TCCACCTCCTTGCCCACACTTGG - Intronic
1070464826 10:76711174-76711196 GCCAAACACCTACCCACACTGGG + Intergenic
1071452130 10:85806306-85806328 TCCACTTTCTTACCAACACTTGG - Intronic
1073573423 10:104600157-104600179 TGCACGCACACACACACACTCGG - Intergenic
1074357169 10:112796629-112796651 TCCAAGGACTTGCCCACACCAGG - Intronic
1076050973 10:127332822-127332844 TCCTGGCACCTCCCCACACTTGG - Intronic
1083612266 11:64009928-64009950 TCCACGCCACTACCCACACCAGG + Intronic
1088329130 11:108632258-108632280 TCCACCCACATACCCACATGTGG + Intergenic
1088556607 11:111067789-111067811 TCCACACCCTCACCAACACTTGG + Intergenic
1089537171 11:119168193-119168215 TCCACACACTTCCACACCCTGGG - Intronic
1089925026 11:122248321-122248343 TCCACGCTCTTTCCCACCCCGGG - Intergenic
1090754477 11:129777670-129777692 TCCACACAATTACCTACACATGG + Intergenic
1091593401 12:1858711-1858733 TCCTTGCCCTTACCAACACTAGG + Intronic
1093872390 12:24307531-24307553 CCCACCCACTCACCCACCCTGGG + Intergenic
1095663727 12:44769458-44769480 CCCACACCCTCACCCACACTTGG - Intronic
1103963654 12:124624717-124624739 TCCAGGCACTTCCCGACCCTTGG - Intergenic
1105043485 12:132981307-132981329 TCCACATACTTGCCTACACTAGG + Intergenic
1110432680 13:75443416-75443438 TCCCTGATCTTACCCACACTTGG - Intronic
1112023124 13:95389345-95389367 TCCACACACTTGCCAACACTTGG + Intergenic
1116733890 14:48663483-48663505 TCCACATCCTTACCAACACTAGG - Intergenic
1118357588 14:65027448-65027470 TCCAGGAACTGACACACACTAGG - Exonic
1118406013 14:65424380-65424402 ACCACACACTTAGCCACACATGG - Intronic
1119504015 14:75155980-75156002 TCCAGGCACTTAACCTCTCTGGG - Intronic
1121096629 14:91221993-91222015 TCCACACACTCAGCCACCCTGGG + Intronic
1124802857 15:32851232-32851254 TCCCAGCACTCTCCCACACTTGG - Intronic
1127216629 15:56830250-56830272 TCCACATCCTTACCAACACTTGG - Intronic
1130121990 15:81058616-81058638 TCCACACACTTTCTCACATTAGG + Intronic
1131426171 15:92347064-92347086 AGCACGCACCCACCCACACTGGG - Intergenic
1131492085 15:92872123-92872145 TCCACATCCTTACCAACACTTGG + Intergenic
1132583016 16:694034-694056 CCCACGCACGCACGCACACTCGG - Exonic
1134979130 16:18593234-18593256 TCCAGGCACCCACCCACCCTGGG + Intergenic
1139961374 16:70719721-70719743 TCCACGTCCTCACCAACACTTGG - Intronic
1140656237 16:77143108-77143130 TTCTCACACTTTCCCACACTTGG - Intergenic
1142196562 16:88741896-88741918 TCCACGCTCCCACCCACACCTGG - Intronic
1142524238 17:527576-527598 TCCACATCCTTACCAACACTTGG + Intronic
1142680073 17:1542271-1542293 TCCATGCATTTAGCCACTCTGGG + Intronic
1148473954 17:47914852-47914874 TCCCCAGACTTACCCACCCTGGG - Intronic
1153100429 18:1462198-1462220 TCCACCCACCCACCCACCCTGGG + Intergenic
1155802730 18:30129643-30129665 TTCACACACTTACCCATATTTGG + Intergenic
1161209125 19:3057130-3057152 TCCCCTCCCTTACCCACCCTTGG - Intronic
1161705290 19:5817711-5817733 TCCTCACACTCACACACACTTGG - Intergenic
1162064786 19:8118836-8118858 TCCACTCACTTTCACACACATGG + Intronic
1164619385 19:29685318-29685340 TCCACGCCCTCACCAGCACTTGG + Intergenic
926836015 2:17022008-17022030 ACCACGTACTTATCAACACTTGG + Intergenic
930147174 2:48019159-48019181 TCCAGGGATTTATCCACACTTGG - Intergenic
932171558 2:69562220-69562242 TCCACATCCTTACCAACACTTGG + Intronic
936339337 2:111617492-111617514 CACACGCACATACACACACTGGG + Intergenic
939165176 2:138633614-138633636 TCCACGTTCTTGCCAACACTTGG - Intergenic
939875106 2:147568789-147568811 TCCATGCACTTACAAACATTAGG - Intergenic
940572397 2:155455040-155455062 TCCATCCACTGACCCCCACTAGG - Intergenic
941129596 2:161630173-161630195 TCCACACACTTACCAGCATTTGG + Intronic
941363249 2:164579530-164579552 CACACACACTTACTCACACTGGG + Intronic
946067040 2:216996784-216996806 TCCACACACAAACCCCCACTGGG - Intergenic
946127836 2:217579879-217579901 TCCAAGCCATTACCCACACCTGG - Intronic
1170964307 20:21052637-21052659 CCCACTCACTTACCCACACTGGG - Intergenic
1174507093 20:51023668-51023690 TCCACGCGCTTACACATCCTGGG + Intergenic
1175259172 20:57663998-57664020 TCCACGCACTTTCACACCCATGG + Intronic
1176949686 21:15030362-15030384 TTCACACAGTTTCCCACACTGGG + Intronic
1177839089 21:26216935-26216957 TCCACACATTTACCCACTGTGGG - Intergenic
1179426882 21:41287574-41287596 TCCAAGCACTTGCCAGCACTAGG + Intergenic
1179658074 21:42857846-42857868 TCCACCCACTTCCGCCCACTGGG - Intronic
1181546505 22:23605479-23605501 TCCACACCCTTTCCCCCACTGGG - Intergenic
1184629204 22:45762826-45762848 GCCACGCAATTACTCTCACTTGG - Intronic
1184862349 22:47179989-47180011 TCCACATCCTTGCCCACACTGGG + Intergenic
950137186 3:10589781-10589803 TCCACATCCTCACCCACACTTGG - Intronic
951782825 3:26384220-26384242 TCTACACACTTTCCAACACTTGG + Intergenic
952097803 3:29975398-29975420 TCCACATCCTTACCAACACTTGG + Intronic
953610307 3:44442460-44442482 TCCACGCACTTACCCACACTTGG + Exonic
955321645 3:57978840-57978862 TCCATGTACTTCCCCACCCTGGG + Intergenic
960439983 3:117675032-117675054 TCCACTGACTTACCCACAGATGG + Intergenic
961664500 3:128487482-128487504 GACACGCACACACCCACACTTGG + Intronic
961831590 3:129625750-129625772 TCCACATCCTCACCCACACTTGG - Intergenic
961964603 3:130889138-130889160 TACACACACTCACTCACACTGGG + Intronic
966535698 3:181031305-181031327 TCCATGGACTTTCCCACTCTGGG - Intergenic
970566011 4:17333408-17333430 TTCACCCACTTAGCCAGACTAGG - Intergenic
972958941 4:44428446-44428468 TCAAGTCACTTACCCACTCTGGG + Intronic
977470115 4:97432677-97432699 TCCATTCTCTTACTCACACTAGG - Intronic
978112109 4:104976071-104976093 TCCCAGCTCTTACCCACACAGGG + Intergenic
980099466 4:128526996-128527018 TCCACGTTCTTACCAACACTTGG + Intergenic
980233651 4:130075833-130075855 CTCACACACATACCCACACTTGG - Intergenic
984582939 4:181531745-181531767 TACACACATTTACACACACTTGG - Intergenic
986734156 5:10655757-10655779 TCCACACAGTTACCCACCGTGGG - Intergenic
987414411 5:17647956-17647978 TCCACGAACAGACCCACACTGGG + Intergenic
988851184 5:35182793-35182815 ACCACGCTCTTAACCTCACTGGG + Intronic
989170990 5:38470041-38470063 TCCAGGCACTCGCCCACACAAGG + Intergenic
991430793 5:66542873-66542895 TCCACACCCTCACCAACACTTGG + Intergenic
992306870 5:75449677-75449699 TCCACGTCCTCACCAACACTTGG + Intronic
997035908 5:130190887-130190909 TACACACACTTACCCCCACTTGG - Intergenic
997529626 5:134573847-134573869 TCCACGCACATACCCCCACCAGG - Intronic
998174047 5:139890120-139890142 TCCACACACTCACCAACACGAGG + Intronic
999751759 5:154632692-154632714 TCCACTCACTCACAAACACTTGG + Intergenic
999901806 5:156093637-156093659 TCCACGCACAAACCCAAATTGGG - Intronic
1002756634 6:166840-166862 TCCAAGCACTTAACCACATACGG - Intergenic
1003324514 6:5082491-5082513 TCCCTGCACCTACCCCCACTTGG + Intergenic
1006042289 6:31266553-31266575 CCCACCCACTCACCCACCCTGGG + Intergenic
1006891386 6:37432450-37432472 TTCATGCACTTACCCCCTCTCGG - Intergenic
1008286711 6:49661803-49661825 CCCACTTCCTTACCCACACTTGG - Intergenic
1009314076 6:62196029-62196051 TCCACTCACTCACCCAGAATGGG - Intronic
1010864507 6:80958102-80958124 TCCACGTCCTCACCAACACTTGG - Intergenic
1011471696 6:87714481-87714503 TCCATGCCCTTACCCACAAGGGG + Intergenic
1013200736 6:107892829-107892851 TCTACGTACTCACCAACACTTGG - Intronic
1013709261 6:112878120-112878142 TACAAGCACTTACACACTCTGGG + Intergenic
1017572662 6:155764098-155764120 TCCACATGCTTACCAACACTCGG - Intergenic
1019502388 7:1370700-1370722 TCCATGCTCATATCCACACTGGG - Intergenic
1019756278 7:2772677-2772699 TCCACGTTCTAACCAACACTTGG - Intronic
1019792533 7:3025957-3025979 TCCACACTCTTACTCACACATGG - Intronic
1021747149 7:23753346-23753368 TCCACACACTCACTCATACTGGG - Intronic
1024017586 7:45332027-45332049 TCCACATCCTTACCAACACTTGG + Intergenic
1024082915 7:45870122-45870144 TCCACATTCTTACCCACATTTGG + Intergenic
1024341302 7:48264424-48264446 TCCACTTCCTTACCAACACTTGG + Intronic
1026363079 7:69620728-69620750 TCCACCCACCTTCCCACACCCGG - Intronic
1029795217 7:102887445-102887467 TACACACACATACACACACTTGG - Intronic
1034520750 7:151617379-151617401 CTCACCCACTTCCCCACACTCGG - Intronic
1035955691 8:4076727-4076749 TCCAAGCCCTGACCCACCCTGGG + Intronic
1042870530 8:73394155-73394177 TCCACGTACTCACCGACACTTGG - Intergenic
1043928583 8:86065422-86065444 TCCATCCCCATACCCACACTTGG + Intronic
1046053400 8:109050592-109050614 TCCACATCCTTACCAACACTTGG - Intergenic
1048322655 8:133412408-133412430 TCCATGCCCTTTCCCACAATGGG + Intergenic
1049516943 8:143064786-143064808 TCCCCGCACGGACCCAAACTGGG - Intergenic
1052426354 9:28310003-28310025 TCCACACCCTTGCCAACACTTGG - Intronic
1053592781 9:39531458-39531480 TCCACCCACCTACTCACTCTAGG + Intergenic
1053850517 9:42286171-42286193 TCCACCCACCTACTCACTCTAGG + Intergenic
1054573522 9:66833821-66833843 TCCACCCACCTACTCACTCTAGG - Intergenic
1057116623 9:92529305-92529327 TCCACACACTCACCAGCACTGGG - Intronic
1057142748 9:92737487-92737509 CCCACGCGCTGCCCCACACTGGG - Intronic
1187988095 X:24836493-24836515 TCCACATTCTTACCAACACTTGG + Intronic
1188330240 X:28861717-28861739 TCCTCACACATACCCTCACTAGG + Intronic
1192733054 X:73820206-73820228 TCAAACCATTTACCCACACTGGG + Intergenic
1196861188 X:120028594-120028616 TCCACATCCTTACCAACACTGGG - Intergenic
1197257342 X:124277274-124277296 TCCACCCTCTAACCAACACTTGG - Intronic