ID: 953610428

View in Genome Browser
Species Human (GRCh38)
Location 3:44443173-44443195
Sequence GGCAGAACACTCTGGGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953610421_953610428 0 Left 953610421 3:44443150-44443172 CCAGGTGAAGGGAGGCAGCACAA 0: 1
1: 0
2: 0
3: 12
4: 199
Right 953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953610428 Original CRISPR GGCAGAACACTCTGGGGGGC TGG Exonic
901678441 1:10900081-10900103 GGCAGATGACTCTGGTGCGCTGG - Intergenic
901793360 1:11666177-11666199 GGTAGAAAAATCTGAGGGGCTGG + Intronic
901943685 1:12683704-12683726 GGGAGAAGACTCTGGTTGGCAGG - Intergenic
903884107 1:26531112-26531134 GGCAGCACACCCTGGGGGCTGGG - Intronic
903897787 1:26620406-26620428 CGCAGAGCACTGTGGGCGGCAGG + Intergenic
903913828 1:26748709-26748731 GACAGAAGCCTTTGGGGGGCAGG + Intronic
904341311 1:29836829-29836851 GGCTGGAGACTCTGGGGGCCTGG - Intergenic
904613307 1:31736832-31736854 GGCAGGGCTCTGTGGGGGGCGGG - Intronic
908115564 1:60936760-60936782 GGCAAAACACTTTGGAGGGCTGG - Intronic
908641561 1:66229303-66229325 GGTAGAAGCCTCTGGGGGGCCGG - Intronic
914919818 1:151839202-151839224 GGCGGCGCAGTCTGGGGGGCTGG + Exonic
915005411 1:152630496-152630518 GGCAGTACTCACTGGGGGCCTGG + Intergenic
915731832 1:158059378-158059400 GGGAGAACGCTCTGGGTGTCTGG + Intronic
916475173 1:165162290-165162312 ATCAGAACACTCTGGGGGACAGG + Intergenic
919469527 1:197961129-197961151 GGCAAAAGACCCTGTGGGGCTGG - Intergenic
919746467 1:201012030-201012052 GGCAGAACAGTCTGGGGGAGAGG + Intronic
920231775 1:204475469-204475491 GGCAGAACCTTCTGGGAGGTGGG + Intronic
920685183 1:208103896-208103918 GGCTACACTCTCTGGGGGGCAGG - Intronic
921804136 1:219435032-219435054 TGCAGCACACTCTGCGTGGCAGG + Intergenic
921984597 1:221298663-221298685 GGCAACACACTCTGGGGAACAGG - Intergenic
922996374 1:229965465-229965487 GCCAGAACACCCTGGAGGGAAGG - Intergenic
1067944593 10:50682110-50682132 CCCAGAACACTCTAGGTGGCAGG - Intergenic
1069334086 10:67327993-67328015 GGCAGAGCACTGGCGGGGGCAGG + Intronic
1070866096 10:79708981-79709003 CCCAGAACACTCTAGGTGGCAGG - Intronic
1070879889 10:79847112-79847134 CCCAGAACACTCTAGGTGGCAGG - Intronic
1071632999 10:87231202-87231224 CCCAGAACACTCTAGGTGGCAGG - Intronic
1071646448 10:87363420-87363442 CCCAGAACACTCTAGGTGGCAGG - Intronic
1072568638 10:96639642-96639664 GACAGAACCCACTGGGGAGCAGG - Intronic
1075031334 10:119026591-119026613 TTCATACCACTCTGGGGGGCTGG + Intergenic
1075263807 10:120984088-120984110 GGCAGGACACACTATGGGGCAGG - Intergenic
1077392982 11:2308473-2308495 GGCCGGTCACTATGGGGGGCTGG - Intronic
1077392988 11:2308490-2308512 GGCTGGTCACTGTGGGGGGCCGG - Intronic
1077393006 11:2308541-2308563 GGCCGGTCACTATGGGGGGCTGG - Intronic
1077393030 11:2308609-2308631 GGCCGGTCACTATGGGGGGCTGG - Intronic
1079983609 11:27177607-27177629 GGCAGAAAACAATGGGGGACAGG - Intergenic
1081789774 11:45774541-45774563 GGAAGAAAAACCTGGGGGGCAGG - Intergenic
1082895747 11:58188269-58188291 GGCAGGACACACAGAGGGGCAGG + Intergenic
1083776095 11:64894940-64894962 GGCAGCACCCTCTGGGTGCCGGG + Exonic
1083827656 11:65212365-65212387 GGGGGAGCTCTCTGGGGGGCCGG - Intergenic
1086139202 11:83475548-83475570 AGCAGAATTCTCTGTGGGGCAGG + Intronic
1088381879 11:109201857-109201879 GGAAGAACACTGTGGGTGGGAGG - Intergenic
1089046086 11:115503490-115503512 GGCAGAGGACGCTGTGGGGCGGG + Intronic
1091392921 12:136836-136858 GGCAGAAGCCTCTGGGGGCATGG + Intronic
1092575791 12:9781706-9781728 GGCTGTGCACTCTGGGAGGCTGG + Intergenic
1093638875 12:21502145-21502167 GGGAGAAGAGTCTGTGGGGCAGG + Intronic
1095101073 12:38184386-38184408 GGCAGAACCCTCCCGTGGGCTGG + Intergenic
1097185216 12:57193053-57193075 GGCAAAAGGCTTTGGGGGGCTGG - Intronic
1098225646 12:68320104-68320126 GGCAGAACAGTATGTGTGGCTGG - Intronic
1099969394 12:89485260-89485282 CACAAAACACTCTGGGAGGCTGG + Intronic
1101321111 12:103673827-103673849 GGCAGAGCACCCTGGAGGACAGG - Intronic
1102579428 12:113876908-113876930 GTCAGAACACTCTGGAGGGAGGG - Intronic
1103811889 12:123621412-123621434 GGCAGATCAGTCTGGAGTGCAGG + Exonic
1103900952 12:124303419-124303441 AGCAGGACAGTGTGGGGGGCAGG - Intronic
1104466232 12:128993198-128993220 GGAAGAACAGGCTGTGGGGCAGG + Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1115788925 14:36857228-36857250 GGAAGACCCCTCTGGAGGGCAGG + Intronic
1117957147 14:61131413-61131435 GGCATAAGACTCCAGGGGGCTGG + Intergenic
1118613517 14:67559743-67559765 GGCAGGAAACTCCGGGGGTCAGG - Intronic
1119307348 14:73618313-73618335 GGCAGAGAATTCTGGGGTGCCGG - Intronic
1119962803 14:78879864-78879886 GGCAAATCAATTTGGGGGGCAGG - Intronic
1121042324 14:90759220-90759242 CTCAGAACTCTCTCGGGGGCGGG - Intronic
1121258484 14:92549277-92549299 GCCAGAACACGCCAGGGGGCGGG - Intronic
1122864231 14:104596311-104596333 GGCATCCCACTGTGGGGGGCAGG + Intronic
1123062906 14:105602230-105602252 GGCAGAGCACCATGGGGGTCTGG - Intergenic
1125530791 15:40412227-40412249 GGCAGAACACAATGGTGAGCTGG + Intronic
1127520247 15:59736377-59736399 GGCAGCACTCTCTGGTGGTCAGG + Intergenic
1128244716 15:66125342-66125364 GGAAGAGGACTCTGGGTGGCTGG - Intronic
1128467287 15:67923497-67923519 TGCAAAACACTTTGGGGGACAGG + Intergenic
1128672170 15:69581880-69581902 GGCAGAAGATTTTGGGGTGCAGG + Intergenic
1131450625 15:92536421-92536443 TGCAGAAAATTCTGTGGGGCAGG - Intergenic
1132720937 16:1315314-1315336 TGCAGAACACCCTGGGGTGAGGG + Intronic
1132764952 16:1529599-1529621 GGCAGCACAGCCTGAGGGGCTGG - Intronic
1133305090 16:4803576-4803598 GGCGGAACACACTGGGGGTGGGG - Exonic
1137578713 16:49620863-49620885 GGCACCTCACCCTGGGGGGCAGG - Intronic
1138285993 16:55810717-55810739 GGCAGGACTTTCTGGTGGGCTGG - Intronic
1139121187 16:64019530-64019552 GGCAGAAAACAGTGGGTGGCAGG - Intergenic
1139504003 16:67390046-67390068 GGCAGGAAGCTCTGGGTGGCAGG + Exonic
1139696914 16:68681608-68681630 GGCAGAACACTTTTGAGGCCAGG + Intronic
1140860116 16:79010798-79010820 GGCAGAGCACACTGGGGCGGGGG + Intronic
1140932015 16:79636434-79636456 GGAAGAGCACACTGGGTGGCAGG + Intergenic
1141421744 16:83922163-83922185 TGGGGAACACTCGGGGGGGCAGG - Exonic
1142357079 16:89606258-89606280 GTCAGAAGGCTCCGGGGGGCGGG + Intergenic
1143120893 17:4606072-4606094 GGCAGAGGGCCCTGGGGGGCTGG + Intronic
1143352281 17:6297680-6297702 AGCAGAACTCTCTGTGGGGATGG + Intergenic
1143953008 17:10648315-10648337 GGAAGACCTCTCTGTGGGGCTGG - Intronic
1144671287 17:17134017-17134039 AGCAGAAGAACCTGGGGGGCTGG - Intronic
1144898728 17:18563856-18563878 GGCAAAAAACTCTGGGCTGCAGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151347524 17:73511276-73511298 GCCAGAACAGTCAGAGGGGCTGG + Intronic
1151954728 17:77374560-77374582 GGCAGAGCCCTCTGGTGGGCCGG + Intronic
1152796325 17:82309342-82309364 GGCAGAGGGCTCTGAGGGGCAGG - Intergenic
1152828655 17:82483796-82483818 GGGAGAGTCCTCTGGGGGGCAGG + Intronic
1152870644 17:82751589-82751611 GCCACAACACGCCGGGGGGCGGG - Intergenic
1156639791 18:39078189-39078211 TGCAGAACACTCTAGGGGAATGG + Intergenic
1160975073 19:1789178-1789200 GGCAGAACAGTGCGGGGGTCTGG - Intronic
1162017802 19:7855065-7855087 CCCAGGACACTCTGGGGAGCAGG - Intronic
1162101752 19:8343113-8343135 GGCAGAGCCCTCAGTGGGGCTGG + Intronic
1164441508 19:28283466-28283488 GGGAGAAGACTCTGGGGAGAGGG - Intergenic
1165050637 19:33139314-33139336 TGCAGATCACTCAGGAGGGCTGG + Intronic
1167150023 19:47702908-47702930 GGCACAGCACGCTGGGAGGCTGG - Exonic
1167729219 19:51241092-51241114 GGCAGAGCACCCTGGGGGTCTGG - Intronic
925508189 2:4593474-4593496 GTCTGAACACTCTGGCTGGCTGG - Intergenic
927495671 2:23550049-23550071 GGAAAAACACCCTGGGGGGCAGG - Intronic
932285508 2:70528505-70528527 GGTAGAACGATGTGGGGGGCGGG + Intronic
932733753 2:74239649-74239671 GGAACATCACTCTGGGGGGCTGG - Intronic
936372199 2:111911614-111911636 GGCAGATCACACTGGAGGTCAGG - Intronic
937287300 2:120761602-120761624 GGCAGAAGGGTCTGGGGGGTCGG + Intronic
941053881 2:160765836-160765858 GGAAGAACCCTCTGGGGAGGTGG - Intergenic
941808981 2:169737024-169737046 GGCAGAACAGTCTTGGGATCAGG + Intronic
943907239 2:193515137-193515159 GGCAGAAAACGATGGGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
946401844 2:219472390-219472412 GGCAGGACACCATGGGGGCCAGG + Intronic
947860170 2:233353004-233353026 TGCAGAACTTTCTGGGGGGACGG + Intergenic
948184651 2:236011259-236011281 GGCAGAACAGTCAGTGGGCCTGG - Intronic
948534364 2:238635074-238635096 GACAGCACACACTGGGAGGCGGG + Intergenic
1171223301 20:23420810-23420832 CCTAGAACACTCTGGGGGGGGGG - Intronic
1171823115 20:29873876-29873898 GGCGGGACGCTCTGGGAGGCCGG + Intergenic
1171896987 20:30816435-30816457 GGCGGGACTCTCTGGGAGGCCGG - Intergenic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1173329421 20:42062101-42062123 GGAAGAACAATCCTGGGGGCTGG - Intergenic
1173496009 20:43518249-43518271 GACAGAAGAATCTGGGGGGTGGG + Intronic
1175948683 20:62570788-62570810 CCCAGAACACACTGGGGAGCTGG - Intergenic
1176301287 21:5100237-5100259 GGCTGGACACGCAGGGGGGCTGG - Intergenic
1176301326 21:5100344-5100366 GGCTGGACACGCGGGGGGGCCGG - Intergenic
1176304843 21:5117992-5118014 AACAGAACACTCCGGGGTGCCGG - Intronic
1179522951 21:41957090-41957112 TGCAGAAGACACTGGAGGGCTGG + Intergenic
1179852211 21:44144038-44144060 AACAGAACACTCCGGGGTGCCGG + Intronic
1179855705 21:44161555-44161577 GGCTGGACACGCGGGGGGGCCGG + Intergenic
1179855743 21:44161662-44161684 GGCTGGACACGCAGGGGGGCTGG + Intergenic
1180709766 22:17831800-17831822 AACAGATCACTTTGGGGGGCAGG + Intronic
1181030047 22:20145306-20145328 GGCAGAGGGCCCTGGGGGGCCGG - Intronic
1181033886 22:20160831-20160853 CTCAGCAGACTCTGGGGGGCTGG + Intergenic
1181055486 22:20258785-20258807 GGCAGAGCACTCCAGGAGGCAGG - Intronic
1181509468 22:23382572-23382594 CTCAGCAGACTCTGGGGGGCTGG - Intergenic
1181861980 22:25826180-25826202 AGCAGATCACTCTGGGGTGAAGG + Intronic
1182828258 22:33284075-33284097 GGCAGACCAGACTGAGGGGCTGG + Intronic
1182967421 22:34535309-34535331 GGAATAAGACTCTGGGGGGATGG - Intergenic
1183301534 22:37061339-37061361 GGCAGGACGCTCTGGGATGCAGG - Intronic
1185049608 22:48547068-48547090 GGCAGTACTCTCTTGGGAGCTGG - Intronic
1185168182 22:49275146-49275168 GGCACCACCCTCTGGTGGGCTGG - Intergenic
950215646 3:11156336-11156358 GCCAAACCACTCTGGGGTGCAGG - Intronic
950502306 3:13372264-13372286 GGAAGAACACTCTGGGTGAAGGG + Intronic
952258381 3:31714880-31714902 GGAAGAACACTCTGGTGGTGTGG - Intronic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
954775157 3:53010434-53010456 GACTGAACCCTCTGTGGGGCTGG + Intronic
956750445 3:72340337-72340359 GGCAGCAGAATTTGGGGGGCAGG + Intergenic
961357792 3:126349877-126349899 GGCACCACCCTCTTGGGGGCTGG + Intronic
961363003 3:126380000-126380022 GGGAGAACACTCATAGGGGCAGG - Intergenic
963969394 3:151413159-151413181 AGCAGAGCCCTCTGGTGGGCGGG + Exonic
965475159 3:169147452-169147474 ATCAGATCACTCTGGGCGGCGGG - Intronic
966575230 3:181493503-181493525 AGCAGAAAGCTCTGTGGGGCGGG + Intergenic
968661643 4:1801139-1801161 GGCAGAGCACCCTGGAGGGGAGG + Intronic
968984919 4:3869898-3869920 GGCAGAACAATGTTGGGGACAGG - Intergenic
969760234 4:9175939-9175961 GGAAGAGCACTCTGAGAGGCTGG - Exonic
969845768 4:9918870-9918892 GGCAGAACACTCTGAGGATGGGG + Intronic
970405328 4:15757505-15757527 TTCAGAACAGTCTGCGGGGCGGG - Intergenic
970770440 4:19606105-19606127 GGGAGAACATGCTGGGGGTCAGG - Intergenic
976290514 4:83412842-83412864 GGCAGGACACTCTGGGATGAGGG - Intronic
984373272 4:178894278-178894300 GGCTGTACACTCTGGCTGGCTGG - Intergenic
985444547 4:190014955-190014977 GGCGGGACGCTCTGGGAGGCCGG + Intergenic
986324879 5:6664956-6664978 GGCAGAAAACACTGTGGGCCAGG + Intronic
992159719 5:73989484-73989506 CCAAGAACACTCTGGGGGTCTGG - Intergenic
994685226 5:102942518-102942540 TTCAGAACACTCTGGGAGGGTGG + Intronic
995823025 5:116259576-116259598 GGCTGAACAGTCTTGGTGGCTGG + Intronic
996493533 5:124127246-124127268 GGCCCAACACTTTGGGAGGCTGG - Intergenic
997411452 5:133694220-133694242 GGCAGCACCCTTTGGAGGGCAGG - Intergenic
999263270 5:150250613-150250635 GCCAGAACTCTGTGGGGGCCTGG + Intronic
999807739 5:155098832-155098854 TGCAGAACACTCTGGGCAGTGGG + Intergenic
1003192481 6:3886806-3886828 GGCCGAACACTCAGTGGTGCTGG - Intergenic
1004120991 6:12822087-12822109 GGTAGAAGACTCTGGGCTGCTGG + Intronic
1004758130 6:18635992-18636014 GTCAGAAGACTCTGGGGTTCTGG - Intergenic
1005562923 6:27059797-27059819 GAAAGAACACTCGGGGGGGGGGG + Intergenic
1006025301 6:31143009-31143031 TGCTGAACACTCTGGAGGCCTGG + Exonic
1006171091 6:32093433-32093455 GGCAGAACATAGTAGGGGGCTGG + Intronic
1016492083 6:144616869-144616891 GGTAGAACGCTATGGCGGGCTGG - Intronic
1016957774 6:149643081-149643103 GGCAGCTCACTCTGTGGAGCTGG - Intronic
1017053771 6:150419400-150419422 GGCAGCACACCCTTGAGGGCGGG + Intergenic
1017119683 6:151012566-151012588 GGCCGAGCACTCTGGGGGACAGG - Intronic
1017562095 6:155639132-155639154 GGCTGGACACTCTGGGATGCTGG + Intergenic
1018314440 6:162542930-162542952 GGAAGAACCCTCAGAGGGGCTGG - Intronic
1019143605 6:169962958-169962980 GGCAGAATCCACTGGGGCGCAGG + Intergenic
1019408241 7:895158-895180 GACAGGACACTCTGGAGGCCAGG - Intronic
1019626617 7:2019143-2019165 GGCAGAGGACTCTGGGGAGGCGG - Intronic
1019905182 7:4057147-4057169 GGCAGAACACTTGGTAGGGCTGG - Intronic
1021415259 7:20376537-20376559 AGGAGAAGACTCTTGGGGGCAGG - Intronic
1024276119 7:47678450-47678472 GGCAGAATAATTTGGGGGGATGG + Intergenic
1024465026 7:49703203-49703225 GTGAGAATACTCTGTGGGGCTGG - Intergenic
1026360362 7:69597815-69597837 GGGAAAACACCCTTGGGGGCTGG + Intergenic
1027254459 7:76422252-76422274 GGCAGAACCCTGTGGGTGCCAGG - Intronic
1029882917 7:103835874-103835896 GAAAGATCACTCTGGTGGGCAGG - Intronic
1032147258 7:129395362-129395384 GGCAGACCTCTGTGAGGGGCAGG + Intronic
1032396486 7:131593662-131593684 GGAAGAACACTATCTGGGGCTGG - Intergenic
1032439029 7:131927774-131927796 GGCAGAGCGCTCTGGGGGCACGG + Intergenic
1033877617 7:145842222-145842244 GGCAGTACTCTCTGTGGGCCTGG - Intergenic
1034432556 7:151048474-151048496 GACAGAGCAGTCTGGGGGGTAGG - Intronic
1035259610 7:157653105-157653127 GGCTGCACCGTCTGGGGGGCAGG - Intronic
1036263858 8:7259686-7259708 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036265154 8:7267308-7267330 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036266455 8:7274930-7274952 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036267761 8:7282552-7282574 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036269064 8:7290174-7290196 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036270358 8:7297796-7297818 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036297527 8:7549259-7549281 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036298831 8:7556906-7556928 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036300136 8:7564556-7564578 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036301440 8:7572201-7572223 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036302737 8:7579850-7579872 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036315898 8:7718225-7718247 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036317205 8:7725873-7725895 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036318513 8:7733521-7733543 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036319822 8:7741168-7741190 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036321129 8:7748816-7748838 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036322438 8:7756464-7756486 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036323746 8:7764112-7764134 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036325048 8:7771760-7771782 GGAAGAGCACTCTGAGAGGCTGG - Intergenic
1036350996 8:8012548-8012570 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036352293 8:8020194-8020216 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036353593 8:8027842-8027864 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036846278 8:12172967-12172989 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1036867641 8:12415286-12415308 GGAAGAGCACTCTGAGAGGCTGG + Intergenic
1040888995 8:52295866-52295888 CGCAGAACATACTGGGAGGCAGG - Intronic
1047213932 8:122862111-122862133 GGCAGAGCACTCCGGGAGGGAGG - Intronic
1048290132 8:133174916-133174938 GGCAGGACACTCTGGGAAGAGGG - Intergenic
1049023574 8:139973748-139973770 TGCAGGACCCTCTGGGAGGCTGG + Intronic
1049103175 8:140593993-140594015 GGCAGACCTCACTGGTGGGCAGG - Intronic
1049470414 8:142772842-142772864 GGCAGAACCATGTGTGGGGCTGG + Intronic
1052966588 9:34345092-34345114 GGCTTATCACTCTGGGAGGCAGG - Intergenic
1053739435 9:41124448-41124470 GCCAGGACAGTGTGGGGGGCGGG + Intergenic
1053749608 9:41237718-41237740 GGCGGGACTCTCTGGGAGGCCGG - Intergenic
1054255054 9:62802599-62802621 GGCGGGACTCTCTGGGAGGCCGG - Intergenic
1054336254 9:63813007-63813029 GGCGGGACTCTCTGGGAGGCCGG + Intergenic
1057886690 9:98834963-98834985 GGGAGAACACTGAGGAGGGCAGG - Intronic
1058451888 9:105104836-105104858 AAAAGAACACTCTGGGGGACTGG + Intergenic
1061046390 9:128167325-128167347 GGAAGAGCACTCTGGGAGGCAGG - Intronic
1061050401 9:128191599-128191621 GGCAGCGCCCTCTGGGGGACGGG + Intronic
1061882767 9:133576316-133576338 GCAAGAACACACTGGGGGGGGGG - Intergenic
1062248813 9:135584088-135584110 GGCAGAACAGGCTGGGAGACGGG + Intergenic
1062285829 9:135772079-135772101 GGCAGCTCACTCGGGGGGCCGGG + Intronic
1062702370 9:137914034-137914056 GGCAGAACATTCCCAGGGGCAGG + Intronic
1203376186 Un_KI270442v1:380425-380447 GGCGGGACGCTCTGGGAGGCCGG + Intergenic
1185698060 X:2210773-2210795 GGCAGGACAGGTTGGGGGGCTGG - Intergenic
1188613223 X:32125170-32125192 GGCAGAACAGTCTGGTGGGTAGG + Intronic
1190321840 X:49184395-49184417 GGGAGAACACTTCTGGGGGCGGG + Intronic
1191670592 X:63745099-63745121 GGCACCACACTCTGAGGGGGTGG + Intronic
1195686132 X:107588073-107588095 GGCAGAAGAGACTGGGGGCCAGG - Intronic
1196343525 X:114625156-114625178 GGCAGAATACTAAGGGGAGCTGG - Intronic
1196826615 X:119745639-119745661 ATCCGAACACTCTGGGAGGCTGG - Intergenic
1197700540 X:129596285-129596307 GGCAGAACTCTGTGAGGGACAGG + Intergenic
1197745711 X:129931581-129931603 GTCAGAACCCTGTTGGGGGCGGG - Intergenic
1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG + Intergenic