ID: 953614714

View in Genome Browser
Species Human (GRCh38)
Location 3:44479194-44479216
Sequence TTGAGCAGGTTCTCTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953614711_953614714 -7 Left 953614711 3:44479178-44479200 CCCATCGTAGAAGAGTTTGAGCA 0: 1
1: 0
2: 1
3: 7
4: 62
Right 953614714 3:44479194-44479216 TTGAGCAGGTTCTCTGTGTTTGG 0: 1
1: 0
2: 1
3: 38
4: 410
953614712_953614714 -8 Left 953614712 3:44479179-44479201 CCATCGTAGAAGAGTTTGAGCAG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 953614714 3:44479194-44479216 TTGAGCAGGTTCTCTGTGTTTGG 0: 1
1: 0
2: 1
3: 38
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953614714 Original CRISPR TTGAGCAGGTTCTCTGTGTT TGG Intergenic
902816697 1:18920607-18920629 CTGAGCAGGCTCTCTGTGGTGGG - Intronic
902837966 1:19058822-19058844 CTGAGCAGCTTCTCTGTGCCAGG - Intergenic
903772944 1:25775472-25775494 TTGAGCATCTTCTGTGTGTCGGG + Intronic
904434481 1:30485381-30485403 ATGAGCAGTTACTGTGTGTTAGG + Intergenic
904693052 1:32309144-32309166 TTGAGCAGGTGCTATATGTCAGG + Intronic
905229465 1:36505768-36505790 TTGAGCAGCTACTATGTGTCAGG - Intergenic
906182787 1:43836439-43836461 ATGAGCAGTTACTCTGTGTAAGG + Intronic
906198322 1:43943704-43943726 ATGATCAGGTTCTCTGGGTTCGG - Intergenic
906317167 1:44793873-44793895 TTGAGCAGCCTCTATGTGTCAGG - Intergenic
907461063 1:54605966-54605988 GTAAGGAGGTTCTGTGTGTTTGG + Intronic
908031451 1:60004312-60004334 TTGAGCATCTTCCCTGTGTTAGG - Intronic
908122275 1:60997471-60997493 TTGAGCATGTTCTTTGTGTCAGG - Intronic
908941536 1:69440930-69440952 TTGAGCAAGTACCATGTGTTAGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911074916 1:93863881-93863903 TTGAGCATCTCCTCTGTGTAAGG - Intergenic
911314550 1:96340324-96340346 TTGGTAAGTTTCTCTGTGTTTGG + Intergenic
911326302 1:96473319-96473341 TTGAGCATTTACTCTGTGGTAGG - Intergenic
911765225 1:101666333-101666355 GTTAACAGGTTCTCTGAGTTAGG + Intergenic
912337308 1:108875227-108875249 TGGAGCAGTTTCTATGTGTCAGG + Intronic
913158039 1:116119263-116119285 TTTAGCATGTCCTCTGTGGTGGG - Intronic
913168004 1:116206748-116206770 TTGAGCAGCTACCCTGTGTCAGG - Intergenic
913307814 1:117450942-117450964 CCCAGCAGGTACTCTGTGTTGGG - Intronic
914333945 1:146698234-146698256 TTGAGGATGTACTCTGTGCTGGG - Intergenic
915500619 1:156314126-156314148 TTCATCATGTTCTCTTTGTTGGG - Intronic
915674348 1:157516453-157516475 TTGAGCAGTTTCTATGTGTCAGG + Intronic
915996177 1:160566339-160566361 TTAAGCCCCTTCTCTGTGTTAGG - Intronic
916519724 1:165552793-165552815 TTGAGCATTTTCTCTGTGTCAGG - Intronic
917058822 1:171014597-171014619 TTGAGCAAGTGCTCTGAGATAGG - Intronic
917080866 1:171255765-171255787 GAAAGCAGGTTCTTTGTGTTAGG - Intronic
917305264 1:173617746-173617768 TAGAGCAGGTGTGCTGTGTTGGG - Intronic
917665224 1:177219802-177219824 ATGAGCAATTTCTCTGTGATTGG + Intronic
917701239 1:177583461-177583483 TTAAGCAGGTTCTCTATGCCAGG + Intergenic
918295047 1:183148655-183148677 CTGACCATGGTCTCTGTGTTGGG + Intergenic
918643762 1:186877306-186877328 TTGAGCACTTACTGTGTGTTAGG - Intronic
918961057 1:191278498-191278520 TTGAGAATGTTGTCTATGTTTGG - Intergenic
918964858 1:191330334-191330356 TTGAGCACGGTCTCTCTGTCTGG + Intergenic
919416369 1:197315619-197315641 TTCAGCTGGTTGTCTTTGTTTGG - Intronic
919895283 1:202005911-202005933 GTGGGCAGGTTCTCTGTCTCGGG - Exonic
919912343 1:202119216-202119238 TTGAGCACCTACTCTGTGTGAGG + Intergenic
920078447 1:203354128-203354150 TTGAGCATCTACTATGTGTTGGG + Intergenic
920311252 1:205049722-205049744 TTGAGCACCTTCTCTGTGCCAGG + Intronic
920649961 1:207830189-207830211 TTGAGCACTTATTCTGTGTTGGG - Intergenic
921267389 1:213433732-213433754 TTGAGCATTTTTTATGTGTTTGG + Intergenic
921792443 1:219305696-219305718 TTGACCACTTACTCTGTGTTGGG + Intergenic
921862473 1:220054188-220054210 TTGAGCACCTACTATGTGTTAGG - Intergenic
924758635 1:246964402-246964424 GTGATCAGGATCTCTGTGTCAGG + Intronic
1063169755 10:3496930-3496952 TTTTGCAGGTTCTTTGGGTTAGG + Intergenic
1063246670 10:4227278-4227300 TTGAGCAGCTGCTCTGTGCCAGG + Intergenic
1063613733 10:7584717-7584739 TTGAGCATGCCCTCTGTGTTAGG + Intronic
1064980699 10:21163615-21163637 TTCTCCAAGTTCTCTGTGTTTGG + Intronic
1065790903 10:29259759-29259781 TGAAGAAGGTTCTCAGTGTTGGG - Intergenic
1066632146 10:37468096-37468118 TTGAGCACCTGCTCTGTGCTGGG + Intergenic
1068224830 10:54094176-54094198 TTGAGCATCTACGCTGTGTTAGG + Intronic
1068851688 10:61749934-61749956 TTGAGAACTTACTCTGTGTTTGG - Intronic
1069375464 10:67788529-67788551 TTGAACAGTTTCTCAGTGTCTGG - Intergenic
1069892298 10:71659445-71659467 TTGAGCTGGCTCTGTGGGTTTGG + Intronic
1071270219 10:84000247-84000269 TTGAGATGTTTCTGTGTGTTTGG - Intergenic
1071437768 10:85662760-85662782 ATGAAAAGGTTCTCTGTGTGAGG + Intronic
1071478402 10:86044087-86044109 TTGAGCAGTGTTTCTGTGTGGGG - Intronic
1071718394 10:88119636-88119658 TTGAGCATTTTTTATGTGTTAGG + Intergenic
1073702916 10:105950263-105950285 TTGAGGAGTTTCTCTGTGGCTGG - Intergenic
1074022044 10:109594191-109594213 TAGAGCAGGTGTGCTGTGTTGGG - Intergenic
1075411131 10:122228729-122228751 TTGAGCACCTACTATGTGTTTGG + Intronic
1076043483 10:127271687-127271709 TTGAGCACCTACTGTGTGTTGGG - Intronic
1078134135 11:8638365-8638387 TTGAACATGTACTCTGTGCTTGG - Intronic
1078248190 11:9595531-9595553 TGTAGCAAGTTCTCTGAGTTTGG + Intergenic
1078535056 11:12166488-12166510 TTGAGCAGCTACTATGTGTCAGG + Intronic
1078926476 11:15880021-15880043 TTGAGCATCTACTCTGTGTCAGG - Intergenic
1079251165 11:18789198-18789220 CTGAGCATTTTCTATGTGTTAGG + Intronic
1079378094 11:19912101-19912123 TTAAGCAGAATGTCTGTGTTTGG + Intronic
1079684308 11:23337886-23337908 TTGAGCACTCACTCTGTGTTAGG - Intergenic
1080296178 11:30731041-30731063 TTGAACACTTTCTATGTGTTAGG + Intergenic
1080874459 11:36263461-36263483 TTGAGCAGGTACTCCGTGCCAGG + Intergenic
1081659181 11:44877462-44877484 TAGAAAACGTTCTCTGTGTTGGG - Intronic
1082019688 11:47521647-47521669 TTGAGCACTTTCTATGTGTCAGG - Intronic
1083404904 11:62449852-62449874 TTGAGCATTTTCTTTGTGCTAGG - Intronic
1084940354 11:72609318-72609340 CTGAGCATCTACTCTGTGTTGGG - Intronic
1085708068 11:78804706-78804728 TTGAGCAGGTGCTGTGGGTCAGG + Intronic
1086521044 11:87667951-87667973 GTGAAAAGGTTTTCTGTGTTGGG - Intergenic
1087190507 11:95249444-95249466 TTGAGCACATACTCTGTTTTAGG + Intergenic
1087267790 11:96079788-96079810 TTGATCAGGTTCCCTGTTTCTGG - Intronic
1087743617 11:101917294-101917316 TTGAGCACCTACTCTGTGCTAGG - Intronic
1088639460 11:111857392-111857414 TTGAGCATCTGCTATGTGTTAGG - Intronic
1089548594 11:119251192-119251214 TTGAGCACTTTCTCTGTGTCAGG + Intronic
1089782110 11:120880879-120880901 TTGAGCACCTTCTCTGTGTCAGG + Intronic
1091719457 12:2801945-2801967 TGGAGCACGTTGCCTGTGTTAGG - Intronic
1092815425 12:12308551-12308573 TGGGGCAACTTCTCTGTGTTAGG - Intergenic
1093798705 12:23345674-23345696 TTGTGAAGGGTCTCTGTGTGGGG + Intergenic
1094726598 12:33125003-33125025 TTTAGCAGTTTTTCTGTCTTAGG - Intergenic
1095075135 12:37911170-37911192 TTGAGAAACTTCTCTGTGATGGG - Intergenic
1095311343 12:40700838-40700860 TTGAGCACTCACTCTGTGTTGGG + Intronic
1095396469 12:41767806-41767828 TTGAGCAGTTACTCTGGGCTGGG - Intergenic
1096327290 12:50675496-50675518 TTAAGCAGTTACTATGTGTTAGG + Intronic
1096809441 12:54160291-54160313 TGCAGCAGGTTCTGTGTGGTGGG + Intergenic
1097340929 12:58437161-58437183 CTGAGCAGGTTCTCTGTGCCAGG - Intergenic
1098297931 12:69023098-69023120 TTGAGCACATTCCATGTGTTGGG + Intergenic
1098361651 12:69659999-69660021 TTGAGCACTGTCTCTGTGGTGGG + Intronic
1098688596 12:73457678-73457700 TTGAAAATGTTCTCTGTGTTTGG + Intergenic
1099147101 12:79060104-79060126 TTGAGCACCTTCGCTGTGTCAGG - Intronic
1099964216 12:89428160-89428182 TTGAGCAGGAACTATTTGTTTGG - Intronic
1100199296 12:92281093-92281115 TTGAGCACTTACTCTGTGCTAGG - Intergenic
1100507970 12:95239348-95239370 TTGAGCACCTACTCTGTGTCAGG - Intronic
1100787825 12:98097147-98097169 TTGAACATCTACTCTGTGTTTGG + Intergenic
1101038460 12:100729402-100729424 TTGAACACGTTCTATGTGGTAGG + Intronic
1101497780 12:105272088-105272110 TTGTCCAGGTTCTTGGTGTTTGG + Intronic
1101736707 12:107468665-107468687 TTGAGCACCTACTGTGTGTTAGG + Intronic
1102701443 12:114842959-114842981 TTGAGCAGCTACTATGTGTTGGG + Intergenic
1102821400 12:115912107-115912129 TTGAGCACTTACTATGTGTTAGG - Intergenic
1102880977 12:116484604-116484626 TTGAGAAGGATCTGTGTGTGTGG + Intergenic
1103174067 12:118846563-118846585 TTGAGCGTGTACTATGTGTTTGG + Intergenic
1103252981 12:119516784-119516806 TTGAGCATTTTCTCTGTGACAGG + Intronic
1103263163 12:119606784-119606806 TTAAGCAGTTACTCTGTGCTAGG - Intronic
1106197607 13:27507668-27507690 TTGAGCAGCTTCTGTGTGCCAGG - Intergenic
1106262281 13:28078187-28078209 TTCAGCAGGGACTCTGTGTGGGG + Intronic
1110065313 13:71097426-71097448 TTGAACAGCTCTTCTGTGTTAGG - Intergenic
1111292075 13:86183666-86183688 TTGTGGATGTTCTCAGTGTTTGG - Intergenic
1111710668 13:91808918-91808940 TTGAGGGCTTTCTCTGTGTTAGG - Intronic
1111892165 13:94097072-94097094 TTGAGCACTTACTGTGTGTTGGG - Intronic
1112076204 13:95916019-95916041 TGGAGCAGGTGTGCTGTGTTGGG - Intronic
1113043185 13:106126282-106126304 TTGGGTAGGTTCTATCTGTTAGG - Intergenic
1114259274 14:21025509-21025531 TTAATCTAGTTCTCTGTGTTCGG - Intronic
1115312994 14:31997711-31997733 TTGCACAGGTTCAATGTGTTGGG - Intergenic
1115959232 14:38816423-38816445 TTGATCACCTACTCTGTGTTAGG - Intergenic
1116412343 14:44639483-44639505 TTGAACAGGTTTTCTGTATGTGG - Intergenic
1119335499 14:73830069-73830091 GTGAGCACTTTCTCTGTGTCAGG - Intergenic
1120392842 14:83929972-83929994 TCCAGTAGGTACTCTGTGTTGGG - Intergenic
1120444973 14:84583550-84583572 TTGAGCACCTACTCTGTGTCAGG - Intergenic
1120653622 14:87163742-87163764 TTGAGCATGTACTATGTGTCAGG + Intergenic
1120843669 14:89108180-89108202 TTGAGCAGCTTCTATATGCTGGG + Intergenic
1120988400 14:90354202-90354224 TTTAGCAGGCCCTCTGTGTGTGG - Intergenic
1121629152 14:95410005-95410027 TTGAACACTTTCTTTGTGTTTGG - Intronic
1122215623 14:100202023-100202045 TTGAGCAGATACTGTGTGCTTGG - Intergenic
1122238549 14:100346536-100346558 TTGAGCAGCTTCTCTGGGTTGGG - Intronic
1123967371 15:25472510-25472532 TTGAGCATGTTCTCTGTGCCAGG + Intergenic
1124351322 15:28957690-28957712 GTGAGCAGGGGCTCTGTGGTGGG + Intronic
1125178916 15:36859320-36859342 TTGAGCAGGTGCTCTAGGCTTGG - Intergenic
1125857364 15:42963192-42963214 TGCAGTGGGTTCTCTGTGTTGGG - Intronic
1126747445 15:51840408-51840430 TTGATCACATGCTCTGTGTTAGG + Intronic
1126978083 15:54208482-54208504 TTGAGCAGCTACTATGTGCTAGG + Intronic
1127609152 15:60620527-60620549 TTGAGCAGCTACTCTGTGGCAGG - Intronic
1127623367 15:60755691-60755713 TTGAACAGCTTCTATGTGTTGGG - Intronic
1128087630 15:64896927-64896949 CTGAGCATGTTCTCTGGGTCAGG + Intronic
1128160112 15:65417993-65418015 TTGAGCACCTACTGTGTGTTAGG - Intronic
1128705292 15:69833811-69833833 TTGAGCACCTACTCTGTGCTAGG - Intergenic
1128755243 15:70179265-70179287 TTGAGCACTTACTATGTGTTGGG - Intergenic
1128938204 15:71766232-71766254 GTGAGGAGGTTTTCTGTTTTAGG - Intronic
1129415905 15:75379566-75379588 TTGAGCAGTTGCTCTGTGTCAGG - Intronic
1131393227 15:92066281-92066303 TTGAACAGGTTCTTTCCGTTGGG - Intronic
1131530911 15:93190916-93190938 CTGAGCACCTTCTCTGTGCTAGG + Intergenic
1131667179 15:94582831-94582853 TTGAGCTGTTCCTCTGTGTCAGG + Intergenic
1133813492 16:9178910-9178932 GTGAGCCTGTTCTCTGTGGTGGG + Intergenic
1133876686 16:9741317-9741339 TTGAGCAGGTATTATGTGTTAGG - Intergenic
1134541020 16:15065457-15065479 TTCAGCAATTTCTCTGTGGTAGG - Intronic
1134640226 16:15824034-15824056 TTGAGCACTTACTATGTGTTGGG + Intronic
1135423553 16:22320939-22320961 TTTAGGAGTTTCTCTGTTTTTGG + Intronic
1135436471 16:22430032-22430054 TTCAGCAATTTCTCTGTGGTAGG - Intronic
1135863928 16:26083003-26083025 TTGAGCATTTTCTATGTGCTTGG - Intronic
1135911681 16:26567115-26567137 TTGATCAGCTACTCTGTGCTCGG + Intergenic
1136634193 16:31508765-31508787 TTGAGCACCTACTATGTGTTGGG - Intronic
1138370608 16:56523664-56523686 TTGAGCATCTTCTCTGTGCCAGG + Intergenic
1139999673 16:71013015-71013037 TTGAGGATGTACTCTGTGCTGGG + Intronic
1140826597 16:78712876-78712898 TTAATTAGGTTCTCTGTTTTGGG + Intronic
1141177018 16:81727609-81727631 TTGAGCACTTACTGTGTGTTGGG + Intergenic
1141195206 16:81855538-81855560 TTGAGCCTATACTCTGTGTTAGG + Intronic
1141333526 16:83133933-83133955 TTGAGTCGCTACTCTGTGTTAGG - Intronic
1141560506 16:84864705-84864727 TTGAGCAGCTGCTGTGTGCTGGG + Intronic
1141750814 16:85956782-85956804 CTGAGCACGTTCTGTGTGATGGG - Intergenic
1141810581 16:86372933-86372955 TTGAGCACCTACTCTGTGCTAGG + Intergenic
1144120878 17:12151091-12151113 TAGAGCAGGTGTGCTGTGTTGGG - Intergenic
1145811866 17:27769137-27769159 TCGGGCAGGTACGCTGTGTTTGG - Exonic
1147039198 17:37704472-37704494 TTCAGGAGGTTCTTTCTGTTTGG - Intronic
1149260541 17:54875725-54875747 TTGAGCATTTGCTCTGTGTCAGG + Intergenic
1149691077 17:58577227-58577249 TTGGGCAGCTTAGCTGTGTTAGG - Intronic
1152427429 17:80225810-80225832 CTGATCAGCATCTCTGTGTTTGG + Intronic
1153482012 18:5556355-5556377 TTGAGCAGCTACTCTGGGTAGGG + Intronic
1153794852 18:8612060-8612082 TTGAGCACCTACTGTGTGTTGGG + Intronic
1154383203 18:13870783-13870805 TTGAGAATTTTCTATGTGTTGGG + Intergenic
1156370886 18:36470268-36470290 TTGAGCATCTTCTGTGTGATAGG - Intronic
1157190043 18:45573802-45573824 ATGAGCAGGAACTCTGTGCTGGG - Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1157634358 18:49135526-49135548 TTGAGCTGCTCCTCTGTATTAGG - Intronic
1157907593 18:51583529-51583551 TTGAGCAGCTTCTGAATGTTTGG - Intergenic
1158467563 18:57704397-57704419 TTGAGCTGGTTCTGTGTATGAGG + Intronic
1158539570 18:58340507-58340529 TAGAGAAGGGGCTCTGTGTTGGG + Intronic
1158946375 18:62450567-62450589 TTGAGTTGTTGCTCTGTGTTGGG + Intergenic
1159268854 18:66122380-66122402 TTTTGCTGGTTCTCTGTGTGTGG + Intergenic
1160937377 19:1603289-1603311 TTGAGCACCTACTATGTGTTAGG - Intronic
1163048368 19:14662165-14662187 TTGAGCAGCTACTATGTGTCAGG + Intronic
1163087992 19:14996733-14996755 TTGAGCATCTGCTCTGTGTCAGG - Intronic
1163257582 19:16166728-16166750 TTGAGCACCTACTATGTGTTGGG + Intronic
1163309019 19:16501388-16501410 TCTAGCAGGTTCTTTCTGTTTGG - Exonic
1164816490 19:31208068-31208090 TTGAACACATTCTCTGTGTGAGG - Intergenic
1164820686 19:31248998-31249020 TTGAGCAGGTTCTAGGGGCTTGG - Intergenic
1165989901 19:39804606-39804628 TTGATCATGATCTCTGTGCTTGG - Intergenic
1166327525 19:42060265-42060287 TTGAGCATGTGCTCTGTGCCAGG + Intronic
925548066 2:5040037-5040059 TTGAGATGCTTCTCTGGGTTGGG + Intergenic
925732976 2:6935436-6935458 CTGAGCTGCATCTCTGTGTTTGG + Intronic
926108758 2:10168882-10168904 TTGAGCATTTGCTCTGTGATGGG - Intronic
926425191 2:12733472-12733494 TTGTTCAGTTTCTCTGTGTATGG + Intronic
926631939 2:15144485-15144507 TTGAGCAACTTCTCTGCGTGAGG + Intergenic
927461239 2:23300049-23300071 TCCAGCAGGTTCTCTGTGCCCGG - Intergenic
928439315 2:31278777-31278799 TTGAGCACCTTGTCTGTGCTAGG - Intergenic
930747231 2:54897369-54897391 TTGAGCACCTACTCTGTGTCAGG + Intronic
931796811 2:65718904-65718926 TTGAGCACTTACTCTGTGTCAGG - Intergenic
932813706 2:74844816-74844838 CTGACCAGGTGCTCTGTGTCGGG - Intronic
932859745 2:75277776-75277798 TTAAGCAGTTACTCTGTGTTAGG + Intergenic
932961904 2:76422278-76422300 TTGGGCAGTTCCTTTGTGTTGGG - Intergenic
933906745 2:86901575-86901597 TTGAGCATTTTCTATGTGCTAGG + Intergenic
934024729 2:87992059-87992081 TTGAGCATTTTCTATGTGCTAGG - Intergenic
935095284 2:99938129-99938151 TTGAGCAGTTACTGTGTGTTAGG - Intronic
935899567 2:107776305-107776327 TTTATATGGTTCTCTGTGTTTGG - Intergenic
936365417 2:111850096-111850118 TTGAGCATTTTCTATGTGCTAGG - Intronic
939794741 2:146628928-146628950 TTGAACATTTTCTCTGTGTCAGG + Intergenic
941018260 2:160381464-160381486 TTGAGCATTTACTCTGTTTTTGG + Intronic
941224037 2:162822681-162822703 TTGAGCAGCTACTCTGTGCAAGG + Intronic
943181266 2:184544798-184544820 TTAACCATGTTCTTTGTGTTAGG - Intergenic
944884212 2:204046505-204046527 TTGAGCACGCACTATGTGTTAGG + Intergenic
945167259 2:206959237-206959259 TTTATGAGTTTCTCTGTGTTTGG - Intronic
945563396 2:211366304-211366326 CTGAGGAAGTTCTCTGTGATAGG + Intergenic
946534518 2:220611316-220611338 TTGAGCATGTACTCTCTGCTGGG - Intergenic
947709181 2:232301069-232301091 TTGAGCACCTCCTATGTGTTAGG + Intronic
948076175 2:235166879-235166901 TTGAGTGCCTTCTCTGTGTTGGG - Intergenic
1172629554 20:36368777-36368799 TTGAGCAATTACTATGTGTTTGG + Intronic
1172954896 20:38749094-38749116 TTGAGCACTTACTCTGTGTCAGG + Intronic
1173274741 20:41569989-41570011 TGGAGCTGGTTCTCAGTGCTTGG - Intronic
1173946938 20:46959151-46959173 CTGAGCATCTACTCTGTGTTGGG - Intronic
1174518318 20:51110419-51110441 TTGAGCATGTACTATGTGCTGGG - Intergenic
1175161977 20:57015268-57015290 TTGAGCAGCTTCTATGTGCCAGG + Intergenic
1175896303 20:62336972-62336994 ATGAGCAGGTGCTGTGTGGTGGG - Intronic
1177679273 21:24343387-24343409 TTAAGCATGATATCTGTGTTAGG + Intergenic
1178278037 21:31256853-31256875 TTGAGCAGGTACTATGTGCTGGG - Intronic
1178747595 21:35267949-35267971 TTGAGCATGTTTTCATTGTTGGG - Intronic
1179606193 21:42517023-42517045 TTGAGCACGTGGTCTGTGCTAGG + Intronic
1182721131 22:32401482-32401504 TTGAGCACTTTCTATGTGTAAGG - Intronic
1183050105 22:35254037-35254059 TTGAGCAGCGTCTTTGTCTTCGG - Intergenic
1183455144 22:37918546-37918568 TTGCTCAGGTTCACTGTGCTTGG + Intronic
1184106411 22:42369678-42369700 TTGAGCACGTACTGTGTGCTAGG - Intergenic
1184485687 22:44777517-44777539 CTGAGCAGGGTCACTCTGTTGGG + Intronic
1184532604 22:45065932-45065954 TTGAGCAATTTCTGTGTGTCGGG + Intergenic
1185066152 22:48632647-48632669 TGGAGGCCGTTCTCTGTGTTGGG + Intronic
949382867 3:3465231-3465253 CTGAGCAGCTGCTCTGTGTGGGG + Intergenic
949785462 3:7735550-7735572 TTGAGCATGTATTATGTGTTGGG - Intronic
950120000 3:10475451-10475473 TTGAGCACCTACTATGTGTTGGG + Intronic
950405522 3:12801928-12801950 CTGAGCCGGTTCTCTGAGATGGG + Intronic
951159061 3:19393944-19393966 TTGAGCATTTTCTATGTGTCAGG + Intronic
951343174 3:21513658-21513680 TTGTGCAGGGTATGTGTGTTGGG + Intronic
952221725 3:31330105-31330127 TTGAGCACTTTCTCTGTGCAAGG - Intergenic
953373607 3:42410242-42410264 TTGAGCACCTACTCTGTATTAGG - Intronic
953614714 3:44479194-44479216 TTGAGCAGGTTCTCTGTGTTTGG + Intergenic
953657275 3:44863670-44863692 TTGAGCTTTTACTCTGTGTTAGG - Intronic
954622024 3:52001841-52001863 TTGAACAGGTTCTCTAGGCTGGG + Intergenic
954814707 3:53271366-53271388 TTTACCAGGGTCTATGTGTTGGG + Intergenic
954975330 3:54688661-54688683 TTGAGCTCTTTCTCTGTGTCAGG - Intronic
955238106 3:57157453-57157475 TTGAGCAGCCACCCTGTGTTAGG - Intronic
955765064 3:62335227-62335249 TTTAGCAAGTTCTCAGTTTTAGG - Exonic
955934092 3:64086321-64086343 TTGAGCATCTACTATGTGTTAGG + Intergenic
955947533 3:64209655-64209677 CTGAGCAGCTACTGTGTGTTAGG + Intronic
955995643 3:64677817-64677839 TTGAGCAACTTCTCTGTGCCAGG - Intronic
956728947 3:72178916-72178938 TTGAGCACCTTCTATGTGTCAGG + Intergenic
957652744 3:83030158-83030180 TTGTGCAAGTACTGTGTGTTTGG - Intergenic
957745529 3:84336773-84336795 TTGAGCATGATCTATGTGGTGGG + Intergenic
958198202 3:90270435-90270457 CTGAGAAGCTTCTCTGTGATGGG - Intergenic
959531129 3:107434755-107434777 TTCAACAGATTCTATGTGTTGGG - Intergenic
959587698 3:108040552-108040574 TTGTGCAAGTTCTATATGTTTGG - Intergenic
959650446 3:108745757-108745779 TTGAGCATTTACTATGTGTTAGG - Intronic
960436031 3:117627938-117627960 TTGAGCACCTACTGTGTGTTTGG + Intergenic
960683209 3:120270675-120270697 TTTAGCACCTTCTTTGTGTTTGG + Intronic
960793893 3:121463548-121463570 TTAAGCAGTTTCTCTGTTATGGG - Intronic
961036051 3:123642334-123642356 TTGAGCACCTTCTGTGTGTTAGG - Intronic
961646612 3:128396085-128396107 TTCAGCAGGTTCTGTTTGGTTGG - Intronic
961672313 3:128542208-128542230 TTGAGGTGGGTTTCTGTGTTGGG - Intergenic
962101728 3:132349764-132349786 TTGAGCATCTGCTCTGTGCTAGG - Intronic
962400869 3:135057634-135057656 TTTTGCAGGTTCTCTGAGTATGG + Intronic
962754253 3:138456224-138456246 TTGAGCACGTGCTGTGTGCTGGG + Intronic
963685832 3:148432703-148432725 TTAAGCAGTTACTCTGTGCTTGG - Intergenic
963835947 3:150057905-150057927 TTAAGCAGCTGCTGTGTGTTGGG + Intergenic
963921881 3:150913572-150913594 TAGCTCAGGTTCTCTGTCTTTGG + Intronic
964875640 3:161365592-161365614 TTGAGCAGCTACTATGTGGTAGG - Intronic
965537935 3:169843438-169843460 TTGTGTCGGTTCTCTGTGTAGGG - Intronic
966261884 3:177988171-177988193 TTGAGCATGTACTATGTGTCAGG - Intergenic
966428466 3:179806695-179806717 TTGAGCATCTGCTCTGTGCTAGG + Intronic
966575131 3:181492533-181492555 TTGAGCAATTTTTCTCTGTTGGG - Intergenic
967001992 3:185344637-185344659 TTAAGGCGGTACTCTGTGTTGGG - Intronic
967318074 3:188169195-188169217 TTGAGCACATTCTCTGTGAGAGG + Intronic
967397484 3:189024016-189024038 TAGAGCAGCTTTGCTGTGTTGGG + Intronic
967988580 3:195114439-195114461 TTGAGCACCTGCTCTGTGTACGG + Intronic
968072130 3:195790919-195790941 TTGAAGTGGTTCTGTGTGTTAGG + Exonic
969474803 4:7415786-7415808 TTGAGCATGCCCTCTGTGCTAGG + Intronic
969555823 4:7909160-7909182 CTGAGCAGTTACTATGTGTTAGG + Intronic
969952579 4:10853635-10853657 TTGAGCAGCTGTGCTGTGTTGGG + Intergenic
970362190 4:15321191-15321213 TTGAGCACTTACTCTGTGTCAGG + Intergenic
971151151 4:24032823-24032845 TTGAGCATGTGGTCTGTGCTGGG - Intergenic
971574295 4:28254110-28254132 TGGAGCAGGTGCACTGTGCTGGG - Intergenic
971626334 4:28924744-28924766 ATGAGCAGCTTCTGTGTGTCTGG - Intergenic
972561408 4:40232161-40232183 TTGAGCACCTACTCTGTGTCAGG - Intronic
973891676 4:55373755-55373777 ATGAGCAGGGTCTCTGTGGAAGG - Intergenic
974782606 4:66572922-66572944 TTGACCAAGTTCTTGGTGTTTGG + Intergenic
975492504 4:75004241-75004263 TTGAGCACTTTCTCTGTGCCAGG + Intronic
975655242 4:76634996-76635018 TTGAGCACCTACTGTGTGTTGGG + Intronic
976269157 4:83213474-83213496 TTGAGCACCTACTCTGTGTCAGG + Intergenic
976335049 4:83875943-83875965 TTGAGCAGTTTTTCTGTCATAGG + Intergenic
976531910 4:86164999-86165021 TTGAGCACCTACTGTGTGTTGGG + Intronic
977723954 4:100272230-100272252 TTGAGCACTTTTTCTGTGTTAGG + Intergenic
978684020 4:111416536-111416558 TTGAGCAGATACTCAGTGGTGGG + Intergenic
978703823 4:111680894-111680916 TTGAGTATGTCGTCTGTGTTTGG + Intergenic
983126936 4:163964776-163964798 TTTAGCATGTTCTGTGTGCTTGG - Intronic
983607014 4:169598570-169598592 TTGAGCATGTGCTTTGTGTTAGG - Intronic
983994078 4:174159858-174159880 TTGAGGAGCATCTCTGTGCTTGG - Intergenic
984539075 4:181014664-181014686 TTGACCAACTACTCTGTGTTAGG - Intergenic
985475480 5:76622-76644 TTGAGCAGCTCCTCTGTCCTGGG + Intergenic
986024068 5:3833568-3833590 TTGACCATGTGCTCTGTGTTAGG + Intergenic
987211641 5:15689658-15689680 TTGAGCATTTACTATGTGTTAGG - Intronic
987263290 5:16225472-16225494 CTGAGCAGCTACTCTGTGTCAGG + Intergenic
990086982 5:51990888-51990910 TTAAGTAGATTCTCTGGGTTTGG - Intergenic
990248313 5:53886173-53886195 TTGATCATTTTCTCTGGGTTTGG - Exonic
991273629 5:64816766-64816788 TAGAGCAGGTTCTCTAAGATGGG + Intronic
991429045 5:66524586-66524608 TTGAGCATGTACTGTGTGTCAGG - Intergenic
991476597 5:67027929-67027951 TTGAGCACCTTCCATGTGTTAGG + Intronic
992891284 5:81206665-81206687 TTGAGCATGTTTTCTGTTTGGGG + Intronic
993100191 5:83528796-83528818 TAGAGCAGGTGCTCTAAGTTAGG + Intronic
994209391 5:97071559-97071581 TTGAGCACCTACTATGTGTTAGG + Intergenic
995356886 5:111248400-111248422 TCGAGCAGGTTCTATGTCCTGGG + Intronic
996349726 5:122525003-122525025 TTGTGCAGTTTCTATGTGTCAGG - Intergenic
997287585 5:132692544-132692566 ATGAGCAGGTTCTTTGTGCTTGG - Intergenic
998916287 5:147015154-147015176 TTAAGCACCTTCTCTGTGTCAGG - Intronic
999053882 5:148553079-148553101 CTGAGCACCTACTCTGTGTTAGG + Intronic
999556864 5:152752592-152752614 TAGAGCTGGTGCTCTGTGCTGGG - Intergenic
1000252892 5:159511997-159512019 TTGAGCATTTTCTATGTATTAGG - Intergenic
1000748378 5:165064204-165064226 TTGAGCAACTACTATGTGTTTGG + Intergenic
1001024378 5:168211199-168211221 GTGAGCAGGGTCTCTCTCTTGGG + Intronic
1001049156 5:168400499-168400521 TTGAGCAGTTACTCTGTGCCAGG + Intronic
1001398020 5:171430437-171430459 TTGAGCACTTCCTCTGTGCTAGG - Intronic
1001453190 5:171841809-171841831 CTGAGCACCTTCTCTGTGCTGGG - Intergenic
1001468254 5:171987938-171987960 TTGAGCATGTACTCTGTTCTAGG - Intronic
1002789758 6:428400-428422 TTGAGCGCCTTCTGTGTGTTGGG - Intergenic
1003164447 6:3663922-3663944 TTGAACATCCTCTCTGTGTTTGG - Intergenic
1003261096 6:4516869-4516891 TTGAGCACTTACTGTGTGTTGGG - Intergenic
1004946806 6:20623955-20623977 TTGAGCATATTCTCTGTGCCAGG - Intronic
1004987445 6:21098701-21098723 TTGAGTGGGTTCTTTCTGTTTGG + Intronic
1007417860 6:41702548-41702570 ATGAGCAGGTTCGCTGGGGTGGG - Intronic
1008717417 6:54305931-54305953 TTGAGCATCTACTATGTGTTAGG + Intergenic
1009666838 6:66692770-66692792 TTTAGCAGTTTCTATGTGGTGGG + Intergenic
1011627180 6:89292073-89292095 TTGAGCTGCTGCTATGTGTTGGG - Intronic
1012937315 6:105381675-105381697 TTGAGCAGCTACTCTTTGCTAGG - Intronic
1013487286 6:110609091-110609113 TTAAGCAACTGCTCTGTGTTGGG + Intergenic
1013835660 6:114332453-114332475 TTGAACAGGTACTGTGTGTCAGG - Intronic
1013942731 6:115684376-115684398 TTGGGCATGTTCTCTGTGCCGGG - Intergenic
1013962964 6:115922990-115923012 TTGAGCATCTGCTCTGTGCTAGG - Intergenic
1014114548 6:117657404-117657426 TTAAGAAGGTTCTCTGTGGCTGG + Intergenic
1014677986 6:124391437-124391459 TTGAGCAGCTACTCTGTGTCAGG - Intronic
1015368538 6:132425047-132425069 TGGAGCAGGTTCACTGTGCTGGG + Intergenic
1015847661 6:137537651-137537673 TTTAACAGGTTCACTGTGATTGG - Intergenic
1016565588 6:145449635-145449657 TTGAGCAGGTTTTTTCAGTTTGG + Intergenic
1016847909 6:148587437-148587459 TAGAGCAGGTGTGCTGTGTTGGG + Intergenic
1017308048 6:152942494-152942516 TTGAGTGCCTTCTCTGTGTTAGG - Intergenic
1018680974 6:166264671-166264693 TTGACCATGTTCTTTGTTTTTGG + Intergenic
1019219452 6:170462769-170462791 TTGAGCAGCTCCTATGTGGTAGG - Intergenic
1020066872 7:5195065-5195087 TAGAGCAGGGTCTCTGGGTTTGG + Intronic
1020466160 7:8482100-8482122 TTCAGCAGTTTCACTCTGTTGGG - Intronic
1022211574 7:28215372-28215394 TTGAGCATTTACTATGTGTTAGG - Intergenic
1022237599 7:28477144-28477166 TTGAACAAGTTCACTGTGATGGG + Intronic
1022256133 7:28660400-28660422 TTGAGCATGTACTATGAGTTAGG + Intronic
1022807560 7:33837859-33837881 TGGAGCACGTGCTCTGTGGTGGG + Intergenic
1023329286 7:39097669-39097691 TTGAGCACCTGCTCTGTGGTAGG + Intronic
1023585086 7:41720918-41720940 TTGAGCATGTACTATGTGTCAGG + Intergenic
1026598946 7:71757474-71757496 TTGGGGAGGTTTTCTGTCTTTGG + Intergenic
1027499992 7:78937919-78937941 TTGAGCAGTTTCTATGTGTCAGG - Intronic
1029068469 7:97875685-97875707 ATGAGCAACTTCTCTGTGCTTGG + Intergenic
1029508182 7:100975547-100975569 TTGAGCAGGTGCTCTGGATAAGG + Intronic
1030327398 7:108235268-108235290 TTGAGGAAGTTCTCTGTCCTAGG + Intronic
1030693974 7:112564245-112564267 TTGAGCATGTACTCTGTGCTGGG + Intergenic
1031134597 7:117872455-117872477 TGGAAAAGGTTCTCGGTGTTTGG - Intronic
1031327379 7:120418572-120418594 TTCACCAGTATCTCTGTGTTGGG - Intronic
1032959381 7:137013830-137013852 TTGAGCAGCTTCTCTTAATTAGG - Intronic
1032976172 7:137225854-137225876 TTGAGCAAGCTCTCTGTTCTGGG - Intergenic
1033317039 7:140306025-140306047 TTAAGCAGGTTCTATGTGAGTGG - Intronic
1033853512 7:145527321-145527343 TTGAGTAGCTTCTATGTGTCTGG - Intergenic
1034522332 7:151630326-151630348 TTGAGAAGAATCTCTGTGTTGGG + Intronic
1034576404 7:152002604-152002626 TTGAGCATTTACTATGTGTTTGG - Intronic
1034846807 7:154454045-154454067 TTGGGCATTTTCTCTCTGTTAGG + Intronic
1035120954 7:156566520-156566542 TTGAGCATCTCCTCTGTGCTAGG + Intergenic
1035956840 8:4089693-4089715 TTGAGCTAGCTTTCTGTGTTGGG - Intronic
1035987402 8:4449921-4449943 TTGAGCATCTTCTGTGTATTGGG - Intronic
1036224546 8:6946495-6946517 TCCATCAGGTTCTCTGAGTTTGG - Intergenic
1036699263 8:11001133-11001155 TTGAACACGTGCTATGTGTTAGG + Intronic
1037198463 8:16221139-16221161 TAGAGCAGTTTTGCTGTGTTGGG - Intronic
1039724250 8:40198184-40198206 TTGAGCACCTTCTATGTGTCAGG - Intergenic
1040300515 8:46185594-46185616 TAGAGCAGGTTGTCTGTGTCTGG - Intergenic
1041011593 8:53549200-53549222 TTGAGCAGGTTACCTCTGGTTGG + Intergenic
1041234397 8:55784906-55784928 TTGAGCATCTGCTCTATGTTGGG - Intronic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1042694811 8:71545235-71545257 TTGAGCATGTACTATGTGTAGGG - Intronic
1043200258 8:77360542-77360564 TTGAGTACTTTCTCTGTATTAGG - Intergenic
1043419817 8:80087061-80087083 TTGACCAGTCTCTCTGTGTGTGG - Intronic
1045220775 8:100197826-100197848 TTGAGCACCTACTCTGTGTCAGG + Intronic
1045546484 8:103133481-103133503 TTGAGCAGTTGCTATGTGTTAGG + Intronic
1047288339 8:123507341-123507363 TTGAGCACCTTCTGTGTGCTGGG - Intronic
1047410176 8:124617990-124618012 TTATGCAGGTTTTCTGTCTTGGG + Intronic
1047719406 8:127625593-127625615 TTGAGAATCTCCTCTGTGTTGGG + Intergenic
1047981990 8:130192802-130192824 TTGAGCACCCTCTCTGTGCTAGG - Intronic
1048165317 8:132057116-132057138 TTGAGCAACTTCTCTATGTCAGG - Intronic
1048634740 8:136283695-136283717 TTGGGCACCTTCTCTGTGTGAGG - Intergenic
1049105467 8:140609718-140609740 TTGAGCACCTGCTCTGTGCTGGG - Intronic
1049364183 8:142228722-142228744 TTGAGCATCTCCTTTGTGTTAGG - Intronic
1050317040 9:4413069-4413091 TTGAGCATGTTGTATTTGTTAGG - Intergenic
1050713465 9:8492594-8492616 TTGAGCACCTTCTGTGTGTCAGG - Intronic
1050947045 9:11537268-11537290 TTGAGCACTTTCTATGTGTCAGG - Intergenic
1051626224 9:19102402-19102424 TTGAGCAGTTACTCTGTGCCAGG - Intronic
1052421769 9:28251584-28251606 TTTAGCAGATTGTCTGTGGTGGG + Intronic
1052940320 9:34127182-34127204 CTGGGCAGGTTCTCAGTGGTGGG - Intronic
1053168589 9:35862120-35862142 TTGAGCACCTACTATGTGTTAGG + Intergenic
1053319944 9:37088163-37088185 TTGAGCACCTACTCTGTGTAGGG + Intergenic
1056063882 9:82913467-82913489 TTGAGCAGTTGCTCTGTGTGAGG - Intergenic
1057450166 9:95151290-95151312 TTGAGCACGTGCTGTGTGTGAGG - Intronic
1057910880 9:99019785-99019807 TTGAGCATGTACTATGTGCTGGG - Intronic
1058380469 9:104371952-104371974 TTCAGCAGGGACTCTGTGTGGGG - Intergenic
1058594347 9:106599580-106599602 TTGAGCAGTTGCTATGTGCTTGG + Intergenic
1059455198 9:114396093-114396115 TTGAGCACCTACTCTGTGTAGGG + Intergenic
1059796442 9:117702209-117702231 TTGAGCACCTACTCTGTGTCAGG + Intergenic
1060429071 9:123533221-123533243 TTGAGCACCTTCTATGTGCTTGG - Intronic
1061156601 9:128865908-128865930 TTGAGCAGCTGCTCTGTGCCAGG - Intronic
1061659694 9:132120807-132120829 TTGAGCACCTTCTCTGTGCCAGG - Intergenic
1185597248 X:1314617-1314639 TTGAGCAGGTTCAGTGTGGTTGG - Intergenic
1185597312 X:1314883-1314905 TTGAGCAGGTTCAGTGTGGTTGG - Intergenic
1185787054 X:2899664-2899686 TTGAGCATGTTCTCTGGGTGGGG + Intergenic
1187255618 X:17639235-17639257 TGGAGCAGCATCTCTGTGCTGGG + Intronic
1188131230 X:26435078-26435100 TTGACCAGGTTCTCTGTTTAGGG - Intergenic
1188829511 X:34879072-34879094 TTGAGCACTTTCTATGTGTCAGG - Intergenic
1189092162 X:38095324-38095346 TTGAGTACGTACTCTGTGTCAGG + Intronic
1189219918 X:39362740-39362762 TTGAGCATCTTCTCTGCTTTGGG + Intergenic
1189502291 X:41574053-41574075 TTGGGGAGTTTCTCAGTGTTGGG + Intronic
1189748822 X:44197644-44197666 TTGTGCATGTGCTCTGTATTGGG - Intronic
1190398009 X:50004203-50004225 TCGAGCAGCTACTGTGTGTTGGG + Intronic
1190455841 X:50627288-50627310 TTGAGCAACTTCTCTGTATCGGG + Intronic
1190692714 X:52925176-52925198 TTGAGCATATACTATGTGTTGGG + Intergenic
1190989237 X:55528323-55528345 TTGAGCAGCTTGTCTGTGCCAGG + Intergenic
1191997575 X:67112944-67112966 TTGAACACCTTCTCTGTGTCAGG - Intergenic
1193366881 X:80644827-80644849 TTTAAAAGTTTCTCTGTGTTTGG + Intergenic
1194644396 X:96440999-96441021 TTGAGCACTTGCACTGTGTTAGG + Intergenic
1196152982 X:112394135-112394157 TGGGGGAGGTTCTCTGGGTTTGG + Intergenic
1196431308 X:115629918-115629940 TTGAACAGGTCATCGGTGTTAGG - Exonic
1196856267 X:119988238-119988260 TTGAGCACATCCTCTGTGTCAGG + Intergenic
1196860064 X:120018280-120018302 TTGAGCACGTCGTCTGTGTCAGG - Intergenic
1198542536 X:137655104-137655126 TTGAGCAGGTTTTATATGTCAGG + Intergenic
1198558895 X:137826737-137826759 TTGAGCACATACTATGTGTTAGG - Intergenic
1199049408 X:143219491-143219513 CTGAGCAGCTTCTGTGTGCTAGG - Intergenic
1199271397 X:145886888-145886910 TTGATCATGTTATCTGTGTCAGG - Intergenic
1200039352 X:153354573-153354595 TTGAGCACCTGCTCTGTGCTGGG + Intronic
1201287338 Y:12390389-12390411 TTGAGCATGTTCTCCGGGTGGGG - Intergenic
1201479648 Y:14426139-14426161 TTGAGCATATTATCTGTGTTTGG - Intergenic