ID: 953614837

View in Genome Browser
Species Human (GRCh38)
Location 3:44480584-44480606
Sequence CTGCAGAAAAAGATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953614837_953614843 22 Left 953614837 3:44480584-44480606 CCACCCTCCATCTTTTTCTGCAG No data
Right 953614843 3:44480629-44480651 ATAAAAGTAGAGAAAGAGAGAGG No data
953614837_953614844 28 Left 953614837 3:44480584-44480606 CCACCCTCCATCTTTTTCTGCAG No data
Right 953614844 3:44480635-44480657 GTAGAGAAAGAGAGAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953614837 Original CRISPR CTGCAGAAAAAGATGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr