ID: 953617682

View in Genome Browser
Species Human (GRCh38)
Location 3:44506794-44506816
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953617682_953617690 17 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617690 3:44506834-44506856 TTCCAAGTAGCTGGGATTACAGG 0: 1904
1: 54917
2: 152010
3: 260731
4: 534754
953617682_953617686 8 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617686 3:44506825-44506847 GCCTCAGCCTTCCAAGTAGCTGG 0: 2677
1: 88944
2: 199316
3: 238775
4: 231215
953617682_953617688 9 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617688 3:44506826-44506848 CCTCAGCCTTCCAAGTAGCTGGG 0: 3527
1: 101662
2: 212141
3: 250946
4: 264986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953617682 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr