ID: 953617686

View in Genome Browser
Species Human (GRCh38)
Location 3:44506825-44506847
Sequence GCCTCAGCCTTCCAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760927
Summary {0: 2677, 1: 88944, 2: 199316, 3: 238775, 4: 231215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953617682_953617686 8 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617686 3:44506825-44506847 GCCTCAGCCTTCCAAGTAGCTGG 0: 2677
1: 88944
2: 199316
3: 238775
4: 231215
953617684_953617686 -1 Left 953617684 3:44506803-44506825 CCTGGATTCAAGTGATTCTCCAG 0: 33
1: 2577
2: 43405
3: 116912
4: 176264
Right 953617686 3:44506825-44506847 GCCTCAGCCTTCCAAGTAGCTGG 0: 2677
1: 88944
2: 199316
3: 238775
4: 231215
953617683_953617686 5 Left 953617683 3:44506797-44506819 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 953617686 3:44506825-44506847 GCCTCAGCCTTCCAAGTAGCTGG 0: 2677
1: 88944
2: 199316
3: 238775
4: 231215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953617686 Original CRISPR GCCTCAGCCTTCCAAGTAGC TGG Intronic
Too many off-targets to display for this crispr