ID: 953617688

View in Genome Browser
Species Human (GRCh38)
Location 3:44506826-44506848
Sequence CCTCAGCCTTCCAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833262
Summary {0: 3527, 1: 101662, 2: 212141, 3: 250946, 4: 264986}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953617682_953617688 9 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617688 3:44506826-44506848 CCTCAGCCTTCCAAGTAGCTGGG 0: 3527
1: 101662
2: 212141
3: 250946
4: 264986
953617683_953617688 6 Left 953617683 3:44506797-44506819 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 953617688 3:44506826-44506848 CCTCAGCCTTCCAAGTAGCTGGG 0: 3527
1: 101662
2: 212141
3: 250946
4: 264986
953617684_953617688 0 Left 953617684 3:44506803-44506825 CCTGGATTCAAGTGATTCTCCAG 0: 33
1: 2577
2: 43405
3: 116912
4: 176264
Right 953617688 3:44506826-44506848 CCTCAGCCTTCCAAGTAGCTGGG 0: 3527
1: 101662
2: 212141
3: 250946
4: 264986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953617688 Original CRISPR CCTCAGCCTTCCAAGTAGCT GGG Intronic
Too many off-targets to display for this crispr