ID: 953617690

View in Genome Browser
Species Human (GRCh38)
Location 3:44506834-44506856
Sequence TTCCAAGTAGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1004316
Summary {0: 1904, 1: 54917, 2: 152010, 3: 260731, 4: 534754}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953617684_953617690 8 Left 953617684 3:44506803-44506825 CCTGGATTCAAGTGATTCTCCAG 0: 33
1: 2577
2: 43405
3: 116912
4: 176264
Right 953617690 3:44506834-44506856 TTCCAAGTAGCTGGGATTACAGG 0: 1904
1: 54917
2: 152010
3: 260731
4: 534754
953617683_953617690 14 Left 953617683 3:44506797-44506819 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 953617690 3:44506834-44506856 TTCCAAGTAGCTGGGATTACAGG 0: 1904
1: 54917
2: 152010
3: 260731
4: 534754
953617682_953617690 17 Left 953617682 3:44506794-44506816 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 953617690 3:44506834-44506856 TTCCAAGTAGCTGGGATTACAGG 0: 1904
1: 54917
2: 152010
3: 260731
4: 534754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953617690 Original CRISPR TTCCAAGTAGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr