ID: 953620602

View in Genome Browser
Species Human (GRCh38)
Location 3:44529354-44529376
Sequence TAGGGAGGCCAGAAATATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953620602 Original CRISPR TAGGGAGGCCAGAAATATAA GGG (reversed) Intergenic
902686397 1:18080383-18080405 CAGAGAGGCCAGAATTAAAACGG - Intergenic
902779409 1:18694783-18694805 TAGGGATCCCAGAAATGTAAGGG - Intronic
905855216 1:41306613-41306635 TATGAAGGCAAAAAATATAAGGG - Intergenic
908507487 1:64819378-64819400 TGGAGAGGCCAGAAAAAAAAAGG + Intronic
909427331 1:75541208-75541230 TAGGGAGTCCAGGTATAGAAAGG + Intronic
910607124 1:89099399-89099421 CAGGGAAATCAGAAATATAAGGG - Intergenic
911239880 1:95453581-95453603 TAGGGTGGCCAGGAAGACAAAGG + Intergenic
911437484 1:97880083-97880105 AATGCAGGCTAGAAATATAAAGG + Intronic
912200013 1:107446208-107446230 TAGGGTTCCCAGAAACATAAGGG + Intronic
913441291 1:118900742-118900764 TAGGGAGTTCAGAATAATAAGGG + Intronic
914241566 1:145856549-145856571 TAGGGAGTCCAGAAGACTAAGGG + Intronic
916742900 1:167661886-167661908 TAGTGAGCACAGAAATATAATGG - Intronic
917849140 1:179045501-179045523 TAGGGAGCCCAGAAATGGAAGGG + Intronic
919539778 1:198831852-198831874 TTGGGAGGCCAGAAAGATGGTGG - Intergenic
919995383 1:202743667-202743689 TAGAGAACCCAGAAATAAAAAGG + Intronic
922860383 1:228811218-228811240 CTGGGAGGCCAGAGATAAAAGGG - Intergenic
924469464 1:244328034-244328056 TTGGGAAACTAGAAATATAAGGG - Intergenic
1063628079 10:7709462-7709484 TAGGGAGGAGAAAAATATACTGG + Intronic
1064003204 10:11680620-11680642 TAGGAAGCCCAGCATTATAAAGG - Intergenic
1065906552 10:30258719-30258741 TATGGAGGACAGAAATGAAAAGG + Intergenic
1069063514 10:63918679-63918701 TATGGAGGCCAGAAACAAGAAGG + Intergenic
1071195425 10:83153609-83153631 TGGGGAGGCCAGAAAGGGAATGG - Intergenic
1075189706 10:120295665-120295687 TGGTGAGCCCAGAAATACAATGG + Intergenic
1075313135 10:121431259-121431281 GAGGGAGGCTACAAATATGATGG - Intergenic
1078076877 11:8170066-8170088 AAAGGAGGCCAAAAAAATAAAGG + Intergenic
1078722748 11:13899054-13899076 TAGGCATGCAAGAAATCTAAAGG + Intergenic
1080010946 11:27458927-27458949 TATGGAGGCAATAAATAAAAAGG + Intronic
1080873234 11:36255287-36255309 TAGGGAGTCCTGAAATATTCAGG + Intergenic
1080922309 11:36721366-36721388 TTGGGCGGCCAGAATTATCAAGG - Intergenic
1081098317 11:38968986-38969008 TAGTGAGGACAAAAATATTATGG - Intergenic
1081222316 11:40476831-40476853 AAAGGAGGCCATAAATATTATGG + Intronic
1081639700 11:44744407-44744429 TGGGAAGGCCAGAAACATGACGG - Intronic
1083596094 11:63918866-63918888 TAGGGAGGCAAGAAATAAGCAGG - Intergenic
1085192670 11:74641789-74641811 TAGGGAAGCTAAAAATACAAAGG - Exonic
1086127089 11:83360122-83360144 CTGGGAGGCCAGAAAGGTAAAGG + Intergenic
1087333247 11:96810880-96810902 TAGGGAGGTCACAAAACTAAGGG - Intergenic
1088408205 11:109504132-109504154 TAGAGGGGCCATAACTATAAAGG - Intergenic
1090223394 11:125051616-125051638 GAGGGAAGAGAGAAATATAAAGG - Intergenic
1091163567 11:133449521-133449543 TCTGGAGGCCAGAAATGTAAGGG - Intronic
1094707610 12:32929482-32929504 TTGGGGGGCCACAAATTTAAAGG - Intergenic
1094737452 12:33251062-33251084 TAAGGAGGCTAGATATATTATGG - Intergenic
1098075223 12:66722656-66722678 TAGGGAGGCCAATAAAATGAGGG + Intronic
1098506718 12:71260901-71260923 TAGAGAGGCCAGACTTACAAGGG - Intronic
1098838860 12:75454878-75454900 TTGAGAGGACAGCAATATAATGG - Intergenic
1106031421 13:26008865-26008887 TATGAAGGCTAGAAATGTAAGGG + Intronic
1108551735 13:51552901-51552923 CAGGGATTCCAGAAACATAAAGG + Intergenic
1109993622 13:70091977-70091999 TAGAGACACCAGAAATATATGGG - Intronic
1110536460 13:76656320-76656342 TAGGTAGACAATAAATATAATGG + Intergenic
1111826939 13:93279740-93279762 TAGTGTGGACAGAAATGTAAAGG + Intronic
1112693200 13:101917914-101917936 AAGTCAGGGCAGAAATATAAGGG + Intronic
1114651028 14:24284651-24284673 TGGGGAGGCCAAAAGTGTAAGGG + Intergenic
1114850847 14:26380768-26380790 GGGGGAGTCCAGAAATATAGTGG - Intergenic
1115530699 14:34324259-34324281 CAGGGAAGCCACAAATTTAATGG - Intronic
1116004547 14:39278318-39278340 TAGGGAAGTCAGAAGTAAAAGGG - Intronic
1117275033 14:54184806-54184828 TAGGGAGTCCAGAAATGTCTTGG - Intergenic
1117432728 14:55685503-55685525 TAGGGAGGGCAGAAGGATAGCGG - Intronic
1120173910 14:81273726-81273748 TAGGGATGCCAGCAACACAAGGG + Intronic
1120238960 14:81927352-81927374 CTGAGAGGCCAGAAATAGAATGG + Intergenic
1121467154 14:94123292-94123314 TGGGGAGGCAAGCAATAGAAGGG + Intergenic
1121968819 14:98337465-98337487 TTGGGAGGCAAGAACTACAAAGG - Intergenic
1124559197 15:30756376-30756398 GAGGGAGGCCAGTAAGAGAAAGG + Intronic
1126774373 15:52087426-52087448 TAGGGAGCCCAAAAAGAGAAGGG - Intergenic
1127911597 15:63420529-63420551 TCTGGAGGCTAGAAATATGAAGG - Intergenic
1128976847 15:72160651-72160673 TGAGGAGGCCAGAAGTATCAGGG - Exonic
1129342706 15:74896635-74896657 TAGGTAGGACAGACATACAAAGG - Intronic
1130359908 15:83173685-83173707 TTGGGAGTCCATAAAAATAATGG - Intronic
1131657514 15:94477057-94477079 TAGGGAGGCAAGCAATCGAAAGG - Intronic
1131711838 15:95064153-95064175 TAGGCAGGACAAAAATAAAAAGG + Intergenic
1131773194 15:95763599-95763621 TAGGGAGGCCAACAAGATAATGG + Intergenic
1133842725 16:9424870-9424892 AAGGGAGGTGAGAAATATATGGG + Intergenic
1137382063 16:48008609-48008631 TAAGAAGGCCAGAAAGATCATGG - Intergenic
1138747074 16:59375976-59375998 GAGGGAGGCCAGTAGCATAAAGG - Intergenic
1139145875 16:64324995-64325017 TAGGCAGAACAGAAACATAAGGG - Intergenic
1140341502 16:74168743-74168765 TAGGGAGGCCATAAGTGTAGTGG - Intergenic
1143735707 17:8910812-8910834 TAGGGAGGCCAGTGAGATATGGG + Intronic
1143996611 17:11011885-11011907 TACTGAGGCCAGAAACCTAAGGG - Intergenic
1144052155 17:11506224-11506246 CAGGGAGGCCAGAAAATAAAAGG - Intronic
1144405412 17:14948213-14948235 CAGGCAGGCAAGAAATATCAAGG - Intergenic
1148177429 17:45579417-45579439 TAGGGAGGTCAAGATTATAAGGG - Intergenic
1148183789 17:45626670-45626692 TCTGGAGGCTAGAAATCTAAGGG + Intergenic
1148264946 17:46218152-46218174 TCTGGAGGCTAGAAATCTAAGGG - Intronic
1155903839 18:31425457-31425479 TAAGGATGCCAGCATTATAAAGG + Intergenic
1156279816 18:35626017-35626039 TAGGGAGGCAAGAAATTGCAGGG - Intronic
1157749340 18:50164263-50164285 TAAGGAGGCCTGAAATAGAGTGG - Intronic
1158144233 18:54292959-54292981 TAGGTAGTCAATAAATATAAGGG + Intronic
1166556810 19:43705542-43705564 TAGGGAGACCAGAAAGAGAAAGG - Intergenic
1168672206 19:58249173-58249195 TATGGAGGCAAGAAACCTAAGGG - Intronic
1168717278 19:58536967-58536989 CATGGAGGACAGAAGTATAAGGG + Intronic
925444140 2:3913153-3913175 TAGGCACGCCAGAAAAATCAAGG + Intergenic
925870357 2:8264922-8264944 TAGGAAAGGCAGAAATAAAAGGG - Intergenic
926539515 2:14157972-14157994 TTGGCCAGCCAGAAATATAAAGG - Intergenic
928017555 2:27672351-27672373 TAGAGAAGACAGAAAGATAAAGG - Intronic
928739933 2:34339318-34339340 TAGGAAGGCAAGAAATTGAAAGG + Intergenic
928879325 2:36079720-36079742 CAGGGACGACAGAAATATCAAGG + Intergenic
931190160 2:59992513-59992535 TAGGGAGGGCAGAACTGAAAGGG + Intergenic
933545217 2:83701693-83701715 TAAGGAAGCAAGAAAGATAAAGG - Intergenic
933592312 2:84246685-84246707 AATGTAGGCCACAAATATAAAGG + Intergenic
936902920 2:117504249-117504271 AGAGGAGCCCAGAAATATAAAGG - Intergenic
940066382 2:149634329-149634351 AAAGGAGACCAGAACTATAAAGG + Intergenic
941334179 2:164220678-164220700 AAGGGAGGCCAAACAAATAATGG + Intergenic
941448451 2:165629877-165629899 CAGGGCAGCCAGAAATAAAAGGG - Intronic
941513191 2:166438806-166438828 TAGTGAGCCAAGAAATATGATGG + Intronic
941600749 2:167540820-167540842 TAGGGATGTTGGAAATATAAAGG + Intergenic
944570410 2:201039004-201039026 AAAGGTGGCCAGAAACATAAAGG - Intronic
945644647 2:212475406-212475428 TAGGGAAGTGAGAAATTTAATGG - Intronic
945715487 2:213353248-213353270 TAATGAGGCCACAGATATAAAGG - Intronic
946793699 2:223327525-223327547 TTGTGAGGCCAGGAATAGAATGG + Intergenic
1169450377 20:5705877-5705899 CAGGGAGCCCAGAAATAATAAGG - Intergenic
1174032850 20:47644672-47644694 TGGGGAGTCCTGAAATAAAAGGG - Intronic
1175186769 20:57184152-57184174 AAGGCAGGCAGGAAATATAAGGG + Intronic
1176954946 21:15091406-15091428 CAGGATGGCCAGAAATAGAAAGG + Intergenic
1178384659 21:32139349-32139371 TAAGGAGGCCAGAAATGTTACGG + Intergenic
1180902665 22:19385929-19385951 AAGGGAGGCCATAAAAATCAAGG - Intronic
1181131999 22:20737473-20737495 CAGGGAGGCCAGAAGTTCAAGGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
950458068 3:13104421-13104443 CAGAGAGCCCAGAAATGTAAGGG - Intergenic
953206000 3:40829802-40829824 TTGGGAGGACAAAAATAGAATGG - Intergenic
953620602 3:44529354-44529376 TAGGGAGGCCAGAAATATAAGGG - Intergenic
954930901 3:54280503-54280525 TAGGGGGGACAGAAATGTGAGGG + Intronic
955803945 3:62714439-62714461 AATGGAGGCCAGAAAGATCATGG + Intronic
955841132 3:63114010-63114032 TAGGGAGCTTAGAAAGATAATGG - Intergenic
957470774 3:80654691-80654713 TGGGGAGGCCTCAAATATCATGG - Intergenic
958746416 3:98140886-98140908 TAGGGAGGTTAGGAATATTATGG - Intergenic
960581056 3:119279277-119279299 TAGGGAGGGCTGAAATGGAAGGG + Intergenic
961362070 3:126374242-126374264 TAGAGAGGCCAGAAAAATTCAGG + Intergenic
963180763 3:142353507-142353529 TAGAGAACCCAGAAATAAAATGG + Intronic
963364861 3:144322121-144322143 TAGGGTGTTCAGAAATATAGGGG + Intergenic
963736995 3:149029235-149029257 TAGGGAGTCCAGAATACTAAGGG + Intergenic
963855041 3:150244658-150244680 TCTGGAAGCCTGAAATATAATGG + Intergenic
964798380 3:160525021-160525043 TAGAGAAACCAGGAATATAATGG - Intronic
966282304 3:178246169-178246191 TATGGAGGCCGGAAATCCAAGGG + Intergenic
970049788 4:11900773-11900795 TAGAGAGGTCAGACATTTAAAGG + Intergenic
970947668 4:21714314-21714336 TAGAGAGCCGAGAAATATCAGGG - Intronic
971025213 4:22582668-22582690 CAGGGAGGCCAGTACTATACAGG + Intergenic
971901741 4:32669034-32669056 TATGGAGACCAAAAATATAGAGG + Intergenic
972095345 4:35341430-35341452 TAGGGAGGCCAAGAAATTAATGG + Intergenic
972108573 4:35525650-35525672 TGGGGAGGCCAGAAAGAGGATGG + Intergenic
973927312 4:55751854-55751876 TAGGGATGCCTGAAATAAGAAGG + Intergenic
975665614 4:76732187-76732209 TAGCGAGGTCAGGAAAATAAGGG + Intronic
975840169 4:78465535-78465557 CAGGGGAGCCAGAAATACAAAGG + Intronic
979206043 4:118039626-118039648 CAGGGAGGCCTGACAGATAAGGG + Intronic
979326890 4:119390634-119390656 TTGGCAGGCCAAAAATATAGAGG + Intergenic
979859522 4:125676460-125676482 TGGGGAGGCCAGAAGTGTGATGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980153316 4:129075505-129075527 TAGAGAGTCCAGAATTACAATGG + Intronic
980578750 4:134720726-134720748 TAGAGAGCCCAGAAATAATACGG + Intergenic
981225966 4:142294638-142294660 TAGGGATCCCAGAGAAATAAAGG + Intronic
981695733 4:147557064-147557086 CAGGCAGGCCAGAAAGCTAATGG + Intergenic
981883707 4:149647310-149647332 AAGGGAGACCTGAAATATAAGGG - Intergenic
983561061 4:169101995-169102017 CAGAGAGGCTAGAAAAATAAAGG - Intronic
984303065 4:177949003-177949025 TAGGGAGGCTATAAAGATAGTGG + Intronic
985959773 5:3292489-3292511 TTGGGATGGGAGAAATATAAAGG + Intergenic
985976951 5:3427157-3427179 TAGGGAGACCAGACCTATGATGG + Intergenic
986182413 5:5405594-5405616 TAGGTAAGCCAGAAATATCCTGG - Intergenic
986421049 5:7582861-7582883 AAGAGAGGCCAGAAAGAAAATGG + Intronic
986895905 5:12367996-12368018 TGTGGAGGGAAGAAATATAAAGG + Intergenic
986982151 5:13460367-13460389 TACGGAGGCCACAAAGATGAGGG - Intergenic
990036184 5:51323146-51323168 TATGGAGTACATAAATATAAGGG + Intergenic
990355803 5:54965012-54965034 CAGGAAGTCTAGAAATATAAAGG + Intergenic
993789543 5:92191012-92191034 TAGGTAAGCCAGAAAAACAAAGG + Intergenic
996115173 5:119610055-119610077 AAGAGATGCCAGGAATATAAAGG - Intronic
996175681 5:120353341-120353363 TAATGAGGCCTGAAATATATTGG + Intergenic
996457214 5:123698611-123698633 TAGAGGGGGCAGAAATATTATGG - Intergenic
997237415 5:132281214-132281236 TAAGGATGTCGGAAATATAAGGG + Intronic
997985731 5:138500185-138500207 TAGGAAGGCCAGAACTGTAGAGG + Intergenic
999325333 5:150640250-150640272 TAGGTAGGCCGGAAATCTGAAGG + Intronic
1000904541 5:166948518-166948540 AAGGGAGGGAAGAAGTATAATGG + Intergenic
1001473960 5:172036115-172036137 CAGGGAGGCCAGAAATGTAGAGG + Intergenic
1001810601 5:174624827-174624849 TAGGGAGGCCATGAATGCAATGG - Intergenic
1003946617 6:11081762-11081784 TAGGGACACCAGTCATATAAGGG - Intergenic
1004647635 6:17577977-17577999 TTGGAAGGTCAGAAATAGAAGGG - Intergenic
1005020465 6:21413106-21413128 AAAGGAGGACAGAAATGTAAAGG + Intergenic
1005341054 6:24844299-24844321 GAGAGAGGCCAGAAATATCCAGG + Intronic
1005405404 6:25482079-25482101 TAGGTAGGACAGAAAGAAAAGGG + Intronic
1005774962 6:29121049-29121071 GAGGGAGGCCAGAAGTCAAAGGG - Intergenic
1008435971 6:51477057-51477079 TAGGAAGACCACAAAGATAAGGG - Intergenic
1009304885 6:62076116-62076138 TAGGGCTGACAGAAATATATGGG - Intronic
1009347918 6:62639573-62639595 TAATGAAGTCAGAAATATAATGG - Intergenic
1010551455 6:77227750-77227772 TTGGGAGACCAGAAGTATACAGG + Intergenic
1010751052 6:79616375-79616397 TAGGAAAGGCAGAAAAATAAAGG + Intergenic
1011262393 6:85483143-85483165 TACGGAAGGCAGAAAGATAAAGG + Intronic
1012325611 6:97912477-97912499 TAGGGAAGAGAGAAATATGAGGG + Intergenic
1012735644 6:102938379-102938401 TAGGAAGGGAAGAAATAAAATGG - Intergenic
1012865463 6:104613016-104613038 TAGGGAAGCCAGAAAGAGACAGG + Intergenic
1015084015 6:129265552-129265574 TAGGGAGGCAAAAAATGTAATGG + Intronic
1015097517 6:129433150-129433172 AAAGAAGGCTAGAAATATAAAGG + Intronic
1015156451 6:130101727-130101749 CAGGAAGGCCAGAAAAATCAGGG - Intronic
1015693687 6:135956148-135956170 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1015693697 6:135956226-135956248 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1020552782 7:9627716-9627738 TTTGAAGGCCAGCAATATAAGGG + Intergenic
1021492931 7:21239627-21239649 TAAGGAGGTGAGAAATATCAAGG - Intergenic
1021704196 7:23350919-23350941 TATTGAGGCCACAAATAAAATGG + Intronic
1022070475 7:26908741-26908763 TAGAGAGACCAGAAATATGAAGG - Intronic
1023099148 7:36696101-36696123 TAGGAAGCCCAGAAATAAACTGG - Intronic
1023905964 7:44521739-44521761 TATTGGGGCCAGATATATAAAGG + Exonic
1026355455 7:69553355-69553377 AAGGCAGGCCAGAATTATCAGGG + Intergenic
1026516256 7:71075223-71075245 CAGAGAGGGCACAAATATAATGG + Intergenic
1028039046 7:86024351-86024373 TAGGGAGGCCACAGAAAGAAAGG - Intergenic
1028221994 7:88208391-88208413 TAAGGATGCCAGAGACATAAGGG - Intronic
1029044281 7:97611636-97611658 TAAGTAAGCCAGGAATATAAAGG + Intergenic
1029985230 7:104916867-104916889 TAGGGAGGCCAGATTGTTAATGG + Intergenic
1031073124 7:117184628-117184650 CAGGGAGGGTACAAATATAAAGG + Intronic
1034427064 7:151019528-151019550 AAGGGAGGGCAGAAAGAGAAAGG - Intronic
1039006221 8:33039969-33039991 TATGGAGGTCTAAAATATAAAGG - Intergenic
1042536803 8:69867294-69867316 TAAGCAGTCAAGAAATATAAAGG + Intergenic
1043284414 8:78511887-78511909 TAGGGAAACCAGAAAGAAAAGGG - Intergenic
1043546583 8:81322260-81322282 AAGGGAGGACAGAGATATAGAGG + Intergenic
1045309337 8:100986964-100986986 TAGCGAGGGAAAAAATATAAAGG + Intergenic
1045703535 8:104894513-104894535 TAGGAAGGACAGAAAGAAAAAGG - Intronic
1046300518 8:112280055-112280077 AAAGGAGCCCAGAAATAAAAGGG + Intronic
1049278244 8:141730688-141730710 AAGGGAGGCCAGAAAGGAAAAGG - Intergenic
1052167607 9:25352406-25352428 TAGGGAAAACAGAAATATAAGGG - Intergenic
1052302945 9:26974139-26974161 CAGGGAGCCAAGAACTATAAAGG - Intronic
1053720404 9:40940252-40940274 AAAGGAGGACAGAAATAAAATGG + Intergenic
1056409192 9:86308599-86308621 TAGGTAGGCTAGAAATAGAAGGG + Exonic
1056500375 9:87202990-87203012 TAGAGAGGCCAGAACCACAAGGG + Intergenic
1058701019 9:107600284-107600306 AAGTGAGGCCAGGAATAAAAGGG - Intergenic
1059504544 9:114786241-114786263 TAGGAAAGCCAGAAATCTTAAGG + Exonic
1061259495 9:129472117-129472139 TGAGGAGGCCAGAAGTATAGGGG - Intergenic
1061379416 9:130244991-130245013 TAGGGAGGCCTGGGATATGACGG + Intergenic
1061642290 9:131968653-131968675 TAGGGAGTCCTGTAAAATAATGG - Intronic
1186240666 X:7561955-7561977 TGGGGAGGCCAGAAATGGAGAGG + Intergenic
1186533423 X:10320846-10320868 TAGGGAGCAGAGAAACATAAAGG - Intergenic
1187248990 X:17580020-17580042 TAGGAAGGCCAGAAAGAAATGGG - Intronic
1187357197 X:18587940-18587962 TAGGGAGCGCTGAAAAATAAAGG - Exonic
1188214024 X:27456269-27456291 GAAGGAGGACATAAATATAATGG - Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191183287 X:57584448-57584470 TAGGGAGGGAAGCAACATAAAGG + Intergenic
1191214087 X:57917951-57917973 TAGGGAGGGAAGCAACATAAAGG - Intergenic
1195118437 X:101723776-101723798 GAGGGAGGACAGAAAGAAAAAGG - Intergenic
1195413874 X:104599136-104599158 TATGGAGGACATAAATATAAAGG - Intronic
1195898888 X:109776961-109776983 TAGGAAGTCCAGAAACATACTGG + Intergenic
1196005701 X:110834985-110835007 TAGGGAGGACAGAATTGGAATGG + Intergenic
1196535905 X:116844176-116844198 AAGGGAAACCACAAATATAATGG - Intergenic
1197495366 X:127173071-127173093 TAGAGAAGCAAGGAATATAATGG + Intergenic
1198835878 X:140804579-140804601 TAGGAAGGCCTCAGATATAATGG - Intergenic
1199558317 X:149133813-149133835 TTGGGAGACCAGAAATGTTAAGG + Intergenic
1199870918 X:151898021-151898043 TAGTGAGGCCAGAGATGAAAGGG - Intergenic
1199994754 X:153015302-153015324 TAGGGATCCCAGAAATAAAGTGG + Intergenic