ID: 953620912

View in Genome Browser
Species Human (GRCh38)
Location 3:44532004-44532026
Sequence TTAACCAATTTGAAGTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953620912_953620918 6 Left 953620912 3:44532004-44532026 CCAAGCAACTTCAAATTGGTTAA No data
Right 953620918 3:44532033-44532055 CAACATGGTCTTCCGCAGGCAGG No data
953620912_953620914 -9 Left 953620912 3:44532004-44532026 CCAAGCAACTTCAAATTGGTTAA No data
Right 953620914 3:44532018-44532040 ATTGGTTAACCTGGCCAACATGG No data
953620912_953620916 2 Left 953620912 3:44532004-44532026 CCAAGCAACTTCAAATTGGTTAA No data
Right 953620916 3:44532029-44532051 TGGCCAACATGGTCTTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953620912 Original CRISPR TTAACCAATTTGAAGTTGCT TGG (reversed) Intergenic
No off target data available for this crispr