ID: 953621270

View in Genome Browser
Species Human (GRCh38)
Location 3:44534948-44534970
Sequence GGTCCAGGGGACCTGAGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621270_953621275 28 Left 953621270 3:44534948-44534970 CCGATGCTCAGGTCCCCTGGACC No data
Right 953621275 3:44534999-44535021 TCTAACTCCTTTGTCTCCGCTGG 0: 17
1: 25
2: 30
3: 68
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621270 Original CRISPR GGTCCAGGGGACCTGAGCAT CGG (reversed) Intergenic
No off target data available for this crispr