ID: 953621528

View in Genome Browser
Species Human (GRCh38)
Location 3:44536891-44536913
Sequence AAGAACAAAAAGGCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621528_953621532 -3 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621532 3:44536911-44536933 CTTTCTATTGAGGCCCTTAACGG No data
953621528_953621535 17 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621535 3:44536931-44536953 CGGATCATGCCCACCCACACTGG No data
953621528_953621538 22 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621538 3:44536936-44536958 CATGCCCACCCACACTGGGGAGG No data
953621528_953621536 18 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621536 3:44536932-44536954 GGATCATGCCCACCCACACTGGG No data
953621528_953621539 23 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621528_953621537 19 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621537 3:44536933-44536955 GATCATGCCCACCCACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621528 Original CRISPR AAGAACAAAAAGGCACAGGA AGG (reversed) Intergenic
No off target data available for this crispr