ID: 953621529

View in Genome Browser
Species Human (GRCh38)
Location 3:44536895-44536917
Sequence TAGAAAGAACAAAAAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621529_953621537 15 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621537 3:44536933-44536955 GATCATGCCCACCCACACTGGGG No data
953621529_953621532 -7 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621532 3:44536911-44536933 CTTTCTATTGAGGCCCTTAACGG No data
953621529_953621536 14 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621536 3:44536932-44536954 GGATCATGCCCACCCACACTGGG No data
953621529_953621535 13 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621535 3:44536931-44536953 CGGATCATGCCCACCCACACTGG No data
953621529_953621539 19 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621529_953621538 18 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621538 3:44536936-44536958 CATGCCCACCCACACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621529 Original CRISPR TAGAAAGAACAAAAAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr