ID: 953621530

View in Genome Browser
Species Human (GRCh38)
Location 3:44536901-44536923
Sequence CCTCAATAGAAAGAACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621530_953621536 8 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621536 3:44536932-44536954 GGATCATGCCCACCCACACTGGG No data
953621530_953621535 7 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621535 3:44536931-44536953 CGGATCATGCCCACCCACACTGG No data
953621530_953621538 12 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621538 3:44536936-44536958 CATGCCCACCCACACTGGGGAGG No data
953621530_953621539 13 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621530_953621537 9 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621537 3:44536933-44536955 GATCATGCCCACCCACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621530 Original CRISPR CCTCAATAGAAAGAACAAAA AGG (reversed) Intergenic
No off target data available for this crispr