ID: 953621533

View in Genome Browser
Species Human (GRCh38)
Location 3:44536924-44536946
Sequence GGGTGGGCATGATCCGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621533_953621539 -10 Left 953621533 3:44536924-44536946 CCCTTAACGGATCATGCCCACCC No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621533 Original CRISPR GGGTGGGCATGATCCGTTAA GGG (reversed) Intergenic
No off target data available for this crispr