ID: 953621539

View in Genome Browser
Species Human (GRCh38)
Location 3:44536937-44536959
Sequence ATGCCCACCCACACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621533_953621539 -10 Left 953621533 3:44536924-44536946 CCCTTAACGGATCATGCCCACCC No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621530_953621539 13 Left 953621530 3:44536901-44536923 CCTTTTTGTTCTTTCTATTGAGG No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621529_953621539 19 Left 953621529 3:44536895-44536917 CCTGTGCCTTTTTGTTCTTTCTA No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data
953621528_953621539 23 Left 953621528 3:44536891-44536913 CCTTCCTGTGCCTTTTTGTTCTT No data
Right 953621539 3:44536937-44536959 ATGCCCACCCACACTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621539 Original CRISPR ATGCCCACCCACACTGGGGA GGG Intergenic
No off target data available for this crispr