ID: 953621673

View in Genome Browser
Species Human (GRCh38)
Location 3:44538121-44538143
Sequence ATGAAGAAGCATGAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953621668_953621673 -4 Left 953621668 3:44538102-44538124 CCTGAGGACCACAGGAGAAATGA No data
Right 953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953621673 Original CRISPR ATGAAGAAGCATGAGGAGGG AGG Intergenic
No off target data available for this crispr