ID: 953624263

View in Genome Browser
Species Human (GRCh38)
Location 3:44557671-44557693
Sequence CTCAGAACACAGTATTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 192}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953624263_953624273 24 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624273 3:44557718-44557740 ATGGTACTCCTGGCAGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 96
953624263_953624269 18 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624269 3:44557712-44557734 ATTCGCATGGTACTCCTGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 45
953624263_953624264 -7 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624264 3:44557687-44557709 TTCTGAGCCTAGCTTCATCCTGG 0: 1
1: 0
2: 1
3: 12
4: 228
953624263_953624270 21 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624270 3:44557715-44557737 CGCATGGTACTCCTGGCAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 85
953624263_953624266 5 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624266 3:44557699-44557721 CTTCATCCTGGAGATTCGCATGG 0: 1
1: 0
2: 0
3: 15
4: 145
953624263_953624268 14 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624268 3:44557708-44557730 GGAGATTCGCATGGTACTCCTGG 0: 1
1: 0
2: 0
3: 0
4: 40
953624263_953624271 22 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624271 3:44557716-44557738 GCATGGTACTCCTGGCAGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 124
953624263_953624272 23 Left 953624263 3:44557671-44557693 CCTGTGAAATACTGTGTTCTGAG 0: 1
1: 0
2: 0
3: 20
4: 192
Right 953624272 3:44557717-44557739 CATGGTACTCCTGGCAGGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953624263 Original CRISPR CTCAGAACACAGTATTTCAC AGG (reversed) Intronic
900740724 1:4329180-4329202 CTCAGATCAGAGGATTTCAGGGG + Intergenic
903341051 1:22654438-22654460 CTCTAAACACAGTCTTTCAAAGG + Intronic
903872049 1:26442931-26442953 CTCAGATAACAGAATTTCAAGGG - Intronic
904864190 1:33563600-33563622 CACAGAAAACAGAATTTCAGAGG + Intronic
909436892 1:75652394-75652416 CTCAGAAGAAAGAATTTAACTGG - Intergenic
909490746 1:76223666-76223688 CCCAGAAAACACTATTACACAGG - Intronic
910214556 1:84830060-84830082 CTCAGAAGAAAGAATGTCACCGG + Intronic
911856082 1:102877231-102877253 CTCAGAATCCAGGATTTCACAGG - Exonic
915642388 1:157238839-157238861 CTCAGAAGAAAGAATTTGACTGG + Intergenic
917309172 1:173660234-173660256 GTCAGAACACAGTATTAAACTGG + Intronic
917390126 1:174527362-174527384 CTCAAAACACAAAAATTCACGGG - Intronic
918296891 1:183165665-183165687 CTCAGAGCACAGTATTGAAAAGG + Intergenic
921272141 1:213481799-213481821 CTGAGGACAAACTATTTCACTGG - Intergenic
921322166 1:213952637-213952659 CTCAGAAAACAGTAGTTCTCCGG - Intergenic
923083667 1:230684519-230684541 ATCAGCACACAGTATTTCAGTGG - Intronic
1063093526 10:2889556-2889578 CACAGAACACAGGAATTCTCAGG - Intergenic
1064950467 10:20843361-20843383 CTCAGAACACTGTATTGTATTGG - Intronic
1065224560 10:23529945-23529967 CTGAGAACAAAGTATTCAACGGG - Intergenic
1066229307 10:33416731-33416753 ATCAAAAGAAAGTATTTCACGGG + Intergenic
1067405436 10:46018960-46018982 CTCAGAATACATTATTTCTGAGG - Intronic
1067549135 10:47221188-47221210 CTCACCACACAGTATTCCAAAGG + Intergenic
1069187781 10:65447944-65447966 CTCAGAAGACTGTTTTCCACAGG - Intergenic
1077388123 11:2284810-2284832 CTTTGAACACAGGATTTTACGGG - Intergenic
1078672193 11:13375553-13375575 CTCAGACCAAAGTATTAAACAGG - Intronic
1080867772 11:36210695-36210717 CTCAGAAGACAGGATTGCACAGG + Intronic
1081800470 11:45855451-45855473 TTCATACCACAGTATTGCACTGG + Intronic
1083829682 11:65223639-65223661 TTCAGAACAGAGTTTTTCAGTGG - Intergenic
1085410110 11:76285795-76285817 CTCAGATCACTGTGTTTCAGAGG - Intergenic
1086670830 11:89545285-89545307 CTCATAACACAGTCTTTCAAAGG - Intergenic
1087041810 11:93808515-93808537 CTCACAATTCAGTATTTCACTGG - Intronic
1087366002 11:97219808-97219830 ATCAGAAGACTTTATTTCACTGG - Intergenic
1087441698 11:98192350-98192372 TTTAGAACACAGTATGTAACAGG + Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1090125468 11:124078908-124078930 CTCAGAAAACAGAATCTCTCTGG - Intergenic
1091689983 12:2589363-2589385 CTGAGGACACAGCATTTGACTGG + Intronic
1092213792 12:6666277-6666299 CTCATAAACCAGGATTTCACTGG + Intergenic
1092553436 12:9528669-9528691 CTCAGAACAGAGCATCTCACTGG + Intergenic
1092731564 12:11539797-11539819 CTCAGAACACAGCCATTCATGGG + Intergenic
1094518663 12:31161954-31161976 CTCAGAACAGAGCATCTCATTGG - Intergenic
1095581898 12:43809685-43809707 CACAAAACACAGCAGTTCACAGG - Intergenic
1100100903 12:91104212-91104234 CTCAGAAACCAGTCTTCCACCGG - Exonic
1100881128 12:99017767-99017789 CTGAGACCACAGTATTGCAGTGG - Intronic
1100925583 12:99544080-99544102 CTTACAACACACAATTTCACAGG - Intronic
1101303576 12:103504997-103505019 CTCAGAACACAGCATTCCCATGG - Intergenic
1102717771 12:114989036-114989058 CTCAGGCCACACTATTTAACAGG - Intergenic
1103105460 12:118220562-118220584 CTCAGAACACTGAATTGCATAGG + Intronic
1103935100 12:124471455-124471477 CTCAGAACACAGCAGTTAACAGG + Intronic
1109560849 13:64048091-64048113 CTCAGAAAACAGAATCTCTCTGG - Intergenic
1110006708 13:70281154-70281176 CTCAGAACACAATTTCTCCCAGG + Intergenic
1110037925 13:70712421-70712443 CTATGATCACAGTATTTAACAGG + Intergenic
1111773063 13:92623759-92623781 CTCAGAAGCAACTATTTCACTGG - Intronic
1114356031 14:21909698-21909720 CTCTGTACACAGTTTTTTACAGG + Intergenic
1115993624 14:39173967-39173989 CTCAGAAAACATTTTTTCACAGG - Intergenic
1116300231 14:43170704-43170726 CTCAGTAAAGAGTCTTTCACAGG - Intergenic
1118630679 14:67699690-67699712 ATCAAAACACAGTAAGTCACAGG + Intergenic
1119138967 14:72247571-72247593 CACAGAAATCAGTATTTTACGGG - Intronic
1121611930 14:95287169-95287191 CTCAAATCACAGGATTTCCCTGG - Intronic
1123480756 15:20629016-20629038 CTCAGGGCACAGTCTCTCACCGG - Intergenic
1123498211 15:20852115-20852137 CTCACAACACAACATTTCAAGGG - Intronic
1123555442 15:21425743-21425765 CTCACAACACAACATTTCAAGGG - Intronic
1123591685 15:21863074-21863096 CTCACAACACAACATTTCAAGGG - Intergenic
1123637254 15:22371351-22371373 CTCAGGGCACAGTCTCTCACCGG + Intergenic
1125195513 15:37041511-37041533 CTCAGAACACAACATTGCTCTGG + Intronic
1129689374 15:77704788-77704810 GTCAGAACACAGTCTATGACTGG - Intronic
1130814170 15:87413494-87413516 CTCAGCTCATAGTATTTCTCTGG + Intergenic
1202963786 15_KI270727v1_random:152953-152975 CTCACAACACAACATTTCAAGGG - Intergenic
1135931903 16:26745440-26745462 CCCAGAACACAGTAAACCACCGG + Intergenic
1136631075 16:31489593-31489615 CTCAAAACACAGGATCTGACTGG + Exonic
1137538089 16:49342538-49342560 CTCAGAACTCAGGATCTCCCAGG - Intergenic
1139068355 16:63347773-63347795 ATGAGAATACAGTTTTTCACAGG + Intergenic
1140785487 16:78337179-78337201 CTAATAACACAGTCTTACACAGG - Intronic
1142912865 17:3110920-3110942 CTCAGACCACAGCAGTCCACAGG - Intergenic
1147695533 17:42349654-42349676 CTCATACCAGAGCATTTCACTGG - Intronic
1154456214 18:14528540-14528562 CTCACAACACAACATTTCAAGGG - Intronic
1155801229 18:30106259-30106281 CAAAGAACACAATATTTCATTGG - Intergenic
1156307403 18:35890535-35890557 CTCAGAACTCAGCATTCCAGAGG - Intergenic
1156533361 18:37839410-37839432 CTGAGAACATAGTTTTTCAGGGG + Intergenic
1157367049 18:47074833-47074855 CTCAGAAGAAAGGATTTCAGGGG - Intronic
1160474550 18:79170792-79170814 TTCAGAACTCAGTATTATACTGG - Intronic
1162610220 19:11743867-11743889 GTCAGAACACAGGATATCAATGG + Intergenic
1162706290 19:12557086-12557108 TTCAGAAGACAATATTTCATAGG - Intronic
1162835424 19:13313964-13313986 CTCACAACACAGGATTTCTAGGG - Intronic
1168325240 19:55535570-55535592 CTCAAAACACAGTTTTTGGCAGG + Intronic
925496653 2:4457746-4457768 TTCAGAACACAGTGTTTTGCAGG + Intergenic
925988192 2:9232639-9232661 CTCAGCACCCAGAATTGCACTGG + Intronic
926355775 2:12039333-12039355 GTAAGCACAAAGTATTTCACAGG + Intergenic
929359120 2:41062605-41062627 TTCTGAACACAGTATTACTCAGG + Intergenic
929632396 2:43477345-43477367 CTCAAAACACATTATAGCACAGG + Intronic
932012382 2:67991532-67991554 CTCAGAACACAGGATTACAGAGG + Intergenic
933089164 2:78098052-78098074 CTCAAAAGACAGTATTTTGCAGG - Intergenic
933240979 2:79919864-79919886 CTAAGAACTGAGTGTTTCACTGG + Intronic
936582258 2:113711460-113711482 CTAATAATACAGTATTTCATAGG - Intronic
938141698 2:128799679-128799701 GTGAGAACACAGGAATTCACAGG + Intergenic
938394259 2:130930798-130930820 CTGTGAACAAAGTATTTCACTGG + Intronic
939358443 2:141135401-141135423 CTAAGAACACATTATTTCCTAGG - Intronic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
940740668 2:157503863-157503885 CGTAGAACAAAGTATATCACTGG - Intergenic
941596992 2:167489604-167489626 GGCAGAACACACTTTTTCACTGG + Intergenic
941857664 2:170247222-170247244 CTCAGAACACAGTAGTACTTGGG + Intronic
947240804 2:227992453-227992475 CTCAGAATACAGATTTTCCCTGG + Intronic
1170726273 20:18929909-18929931 TTTAGAAAATAGTATTTCACTGG - Intergenic
1171999765 20:31764502-31764524 TTCAGAGCACAGAATTTCAATGG - Intronic
1172208311 20:33180293-33180315 CTCTGTACACACTATCTCACTGG + Intronic
1172214165 20:33223234-33223256 CACAGGGCACATTATTTCACTGG - Intronic
1172399671 20:34638964-34638986 ATTAGAAAACAGTATTTCAGAGG + Intronic
1176817951 21:13624796-13624818 CTCACAACACAACATTTCAAGGG + Intronic
1177439498 21:21102393-21102415 CTCACAATACAGGATTTCTCAGG + Intronic
1178132698 21:29591229-29591251 CACAGAACACAGTACATCAGAGG + Intronic
1179067515 21:38039960-38039982 CTCATTACAAAGTATTGCACTGG + Intronic
1181421169 22:22799972-22799994 CTCTGAACACAGCATTCCTCGGG + Intronic
953624263 3:44557671-44557693 CTCAGAACACAGTATTTCACAGG - Intronic
954616176 3:51969757-51969779 CCCAGAACACAGTTTAGCACAGG + Intronic
955486140 3:59436697-59436719 TTCAGAACACAGAATTCCCCAGG + Intergenic
957226576 3:77456507-77456529 ATTAGAACTCAGTATTTAACTGG - Intronic
957341358 3:78901751-78901773 GACAGAACACAGTATTCCATAGG + Intronic
958778903 3:98518349-98518371 ATCTGAAGACAGTATTTCATGGG + Intronic
959977607 3:112479661-112479683 CTGTTAGCACAGTATTTCACAGG + Exonic
960513119 3:118574109-118574131 CAAATGACACAGTATTTCACTGG - Intergenic
962752113 3:138441132-138441154 CTCGGCCCACAGTCTTTCACAGG + Intronic
963211832 3:142701191-142701213 CTGAGAACTCAGTATTTCCAAGG + Intronic
963488471 3:145967641-145967663 CACAGAACTCAGTATTTAGCGGG + Intergenic
963647994 3:147941580-147941602 CTCTGAAGTCAATATTTCACTGG + Intergenic
966148380 3:176838413-176838435 CTGAGAACCCAGAAGTTCACTGG - Intergenic
967735087 3:192943300-192943322 TTCTGAACACAGATTTTCACAGG + Intergenic
967827163 3:193886233-193886255 CTCAGAAGAAAGAATTTGACCGG - Intergenic
968002038 3:195212757-195212779 CACAGAAGACAGTTTTTCAGTGG - Intronic
972881751 4:43432925-43432947 GTCAGAACACAGGATTTCTAGGG + Intergenic
972971465 4:44581788-44581810 TTCAGAAGAAAGTATTTCAATGG + Intergenic
979192010 4:117873274-117873296 CCCAGAACACATTTTTACACTGG - Intergenic
979809940 4:125024877-125024899 TTCAGAAGACAGTTTTTCATGGG + Intergenic
981217655 4:142190065-142190087 CTCAGATGACAGTATTTTATTGG + Intronic
982971684 4:161996290-161996312 GCCAGAGCAGAGTATTTCACTGG - Intronic
983881038 4:172933085-172933107 ATCAGAAAACAATAGTTCACAGG + Intronic
985847535 5:2362668-2362690 CTCAGAACCTAGTGCTTCACTGG - Intergenic
986177771 5:5366455-5366477 CTGAGAACACAGGGTCTCACTGG + Intergenic
986633709 5:9799870-9799892 TTCCTAACACAGTATTTCAGTGG + Intergenic
987025783 5:13925257-13925279 ATCAGAAAACAGAATTTCAAAGG + Intronic
987250593 5:16096597-16096619 ATAAGAACACAGTATTTGCCTGG - Intronic
989545461 5:42667382-42667404 CACAGAACTCAGTATTTGATGGG + Intronic
992585985 5:78240356-78240378 TACAGAAAACAGTATTTTACTGG + Intronic
992859607 5:80897284-80897306 TTCAGAACACAGTATAGTACAGG - Intergenic
993763771 5:91830480-91830502 CTCAGCACACAGTATATTCCTGG + Intergenic
993802169 5:92355648-92355670 CTCAGAGGAGAGTTTTTCACAGG + Intergenic
994518672 5:100801333-100801355 CCCAAAACACAGTATTTTAGAGG + Intergenic
994657518 5:102612006-102612028 CTCAGAAATCAGTATCTCAATGG - Intergenic
995665558 5:114538038-114538060 CACAGAACATAGTATTATACAGG + Intergenic
996134401 5:119821329-119821351 CTGAGCACACAGTATGTCCCAGG - Intergenic
997053916 5:130417346-130417368 CTCACAACACAGTTTTTCTTAGG - Intergenic
997528545 5:134568617-134568639 CTCAGAAAGCAGCATTTGACAGG - Intronic
997534112 5:134603370-134603392 TTCAAAACCCAGCATTTCACAGG - Exonic
998452374 5:142244914-142244936 CTCAGAACCCAGCACTCCACTGG + Intergenic
999123819 5:149231271-149231293 GTCAGAACACAGTAATTCAGAGG - Intronic
1000963178 5:167624682-167624704 CTCAGAACACAGCTTTTAAGTGG - Intronic
1002621788 5:180493623-180493645 GTCGAAACACAGTATTTGACCGG - Intergenic
1003540033 6:7010510-7010532 CCCAGAAAACAGTATTTCTGGGG + Intergenic
1003834887 6:10060228-10060250 CGCAGAAGACATTATATCACAGG - Intronic
1007654484 6:43444089-43444111 CTGAAAACTCAGTATTTCAGAGG - Intronic
1009338884 6:62529178-62529200 CTCAAAATACATTATTTAACTGG + Intergenic
1010502591 6:76619174-76619196 CTCAGCACAAAGTGTTTCAGGGG + Intergenic
1011527325 6:88279021-88279043 CTCAGAGCACAATATTCCATAGG + Intergenic
1012987050 6:105886119-105886141 GTCAGAACACACCATTTCCCTGG + Intergenic
1014007230 6:116433529-116433551 CTCTGCACACAGAATTTCTCTGG + Exonic
1014726094 6:124973690-124973712 CTCAGGCCACAGTAGTTCACTGG - Intronic
1016535170 6:145101992-145102014 CTGAGAAAGCAGTATTTCAGTGG + Intergenic
1016965146 6:149712004-149712026 CACAGGACACATTACTTCACAGG + Intronic
1018113181 6:160556899-160556921 CACAGAATACACTATTTCTCTGG - Intronic
1022053832 7:26708203-26708225 TTCAAAACACATTATTACACTGG + Intronic
1022898904 7:34782090-34782112 CTGAGAACACAGTCTTTCAGTGG - Intronic
1024136016 7:46409447-46409469 TACAGAAGACAGTATTTCTCAGG - Intergenic
1024277416 7:47689404-47689426 CTCAGAAGAAACTATTTCACGGG - Intergenic
1026435498 7:70393430-70393452 TCCTGGACACAGTATTTCACTGG + Intronic
1028005105 7:85556009-85556031 ATCAGAGCATAGGATTTCACTGG - Intergenic
1029851172 7:103462959-103462981 CTCACAACACAGTCCCTCACGGG + Intergenic
1030482940 7:110127075-110127097 CTCAGAGAAAAGCATTTCACAGG + Intergenic
1030635549 7:111944341-111944363 TTCAGTATTCAGTATTTCACAGG + Intronic
1031862037 7:126991390-126991412 TTCGGAACACAGTCTTTTACTGG - Intronic
1032573794 7:133030180-133030202 CTCAGAACCCATTACCTCACTGG - Intronic
1033670227 7:143485393-143485415 CTCAGGATATAGTAATTCACTGG + Intergenic
1034156369 7:148959126-148959148 CTCAGAAAACAGAATTTCTCTGG + Intergenic
1041492168 8:58445431-58445453 CCTAGAACACAGTGTTTCAACGG - Intronic
1042446192 8:68888335-68888357 CTCTGAACACTGTATTTTAAGGG + Intergenic
1043679439 8:83003681-83003703 CTCATATCACAGTATTTAATGGG + Intergenic
1043772589 8:84223623-84223645 CTCAGAACAGAGTATTTGGTTGG + Intronic
1045258988 8:100555396-100555418 CTGAGAGCACAGTATTTTTCTGG - Intronic
1050030899 9:1384129-1384151 CTCATAAATAAGTATTTCACTGG - Intergenic
1050234457 9:3563093-3563115 CTCATGGCACAGTCTTTCACAGG + Intergenic
1051339518 9:16098621-16098643 CTTAGAACACAGAATTACAAGGG + Intergenic
1053319344 9:37081178-37081200 GGCAGAGCACAGTATTTCAGTGG - Intergenic
1053323657 9:37121818-37121840 AACAGAGCACAGTATTTCAGTGG - Intronic
1054721692 9:68610209-68610231 CTCTGCACACAGAATTTCTCTGG + Intergenic
1055462200 9:76529659-76529681 CTCAGAGACCAGTAATTCACTGG + Intergenic
1056303508 9:85267220-85267242 CTCAGAAAAAAGAATTTGACTGG + Intergenic
1056382444 9:86067423-86067445 AAAAGAAAACAGTATTTCACTGG + Intronic
1058684588 9:107469042-107469064 CTCTGTACTCAGCATTTCACAGG - Intergenic
1059998477 9:119936846-119936868 CTCAGCACACCATATTTCACAGG - Intergenic
1062057046 9:134474195-134474217 CTCAGGACACACTATCTTACAGG - Intergenic
1062512323 9:136913591-136913613 CTCAGAACATAGTATGTAGCCGG - Intronic
1203529408 Un_GL000213v1:124707-124729 CTCACAACACAACATTTCAAGGG - Intergenic
1185943662 X:4349869-4349891 CTCACAAAACAATATTTCAGTGG - Intergenic
1186725788 X:12357196-12357218 CTTAGAACACTGTATGTCATTGG + Intronic
1189730851 X:44019179-44019201 CTCTGAACACAGAATTTCAGTGG - Intergenic
1190068174 X:47257185-47257207 CTCAGAAGAAAGAATTTGACTGG - Intergenic
1193978450 X:88152133-88152155 CTCAGACCTCAGTTTCTCACTGG + Intergenic
1194697654 X:97074761-97074783 CACCCAACACAGTATTTCTCAGG - Intronic
1196831330 X:119777805-119777827 TTCAAAAGACAGCATTTCACTGG - Intergenic
1197332245 X:125168139-125168161 CTCAGATAACAGTATTTAATAGG + Intergenic
1197641299 X:128971099-128971121 CTTAGAACAACATATTTCACGGG + Intergenic
1198212250 X:134527292-134527314 CTGCCAACACAGTATTTCTCTGG + Intergenic
1200504590 Y:3996654-3996676 CTCAGAAAAGAGAATTTGACTGG + Intergenic
1202162515 Y:21950475-21950497 TTCAGAACTCAGTGTTTCCCTGG - Intergenic
1202228841 Y:22635893-22635915 TTCAGAACTCAGTGTTTCCCTGG + Intergenic
1202314315 Y:23560274-23560296 TTCAGAACTCAGTGTTTCCCTGG - Intergenic
1202556487 Y:26110321-26110343 TTCAGAACTCAGTGTTTCCCTGG + Intergenic