ID: 953626822

View in Genome Browser
Species Human (GRCh38)
Location 3:44578885-44578907
Sequence CGGGAGCAGAGCGCCCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953626822_953626833 8 Left 953626822 3:44578885-44578907 CCCTCACGGGCGCTCTGCTCCCG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 953626833 3:44578916-44578938 CCACCCTCAGCTGGTCCTGCAGG 0: 2
1: 0
2: 4
3: 51
4: 336
953626822_953626838 29 Left 953626822 3:44578885-44578907 CCCTCACGGGCGCTCTGCTCCCG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 953626838 3:44578937-44578959 GGAGCCGGTTCTGCTCCAGAAGG 0: 2
1: 0
2: 0
3: 10
4: 125
953626822_953626829 -1 Left 953626822 3:44578885-44578907 CCCTCACGGGCGCTCTGCTCCCG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 953626829 3:44578907-44578929 GGCCCAGGGCCACCCTCAGCTGG 0: 2
1: 0
2: 6
3: 51
4: 396
953626822_953626836 14 Left 953626822 3:44578885-44578907 CCCTCACGGGCGCTCTGCTCCCG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 953626836 3:44578922-44578944 TCAGCTGGTCCTGCAGGAGCCGG 0: 2
1: 0
2: 2
3: 48
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953626822 Original CRISPR CGGGAGCAGAGCGCCCGTGA GGG (reversed) Intronic
902920874 1:19665387-19665409 TGGGAGCAGAGCCCCCTGGAGGG - Exonic
905180108 1:36160301-36160323 AGGGAGCAGAGAGCCTGGGAGGG + Intronic
905901069 1:41582274-41582296 AGTGAGCAGAGCGTCCGTGTGGG + Exonic
913592571 1:120342435-120342457 CGGGAGCTGAGCGGCAGTGTAGG + Intergenic
913650777 1:120912695-120912717 CGGGAGCTGAGCGGCAGTGTAGG - Intergenic
914170335 1:145216372-145216394 CGGGAGCTGAGCGGCAGTGTAGG + Intergenic
914525453 1:148460338-148460360 CGGGAGCTGAGCGGCAGTGTAGG + Intergenic
914598221 1:149175492-149175514 CGGGAGCTGAGCGGCAGTGTAGG - Intergenic
914640948 1:149606790-149606812 CGGGAGCTGAGCGGCAGTGTAGG - Intergenic
922712722 1:227845444-227845466 TGGGAGGAGGGCTCCCGTGAGGG - Intronic
924557581 1:245130875-245130897 CGGGAGAAGAGGTCCTGTGAAGG - Intergenic
1067772250 10:49135153-49135175 CGAGAGCCCAGAGCCCGTGAGGG - Intergenic
1074088493 10:110226466-110226488 GGGGAGGGGAGCGCGCGTGAGGG + Intronic
1076064736 10:127440270-127440292 TGGGAGCAGATCTCTCGTGAAGG - Intronic
1076096628 10:127738362-127738384 CGGGTACAGAGTGCCCGTCAAGG + Intronic
1083213628 11:61204765-61204787 CGGGAGCACAGTGCCTTTGAAGG + Intronic
1083216511 11:61223601-61223623 CGGGAGCACAGTGCCTTTGAAGG + Intronic
1083219393 11:61242427-61242449 CGGGAGCACAGTGCCTTTGAAGG + Intronic
1090948149 11:131449536-131449558 AGGGAGGAGAGTGCCTGTGATGG + Intronic
1091807363 12:3366016-3366038 CGGGAGAAGCGCGCCCGCGTGGG - Intergenic
1092523330 12:9294619-9294641 CGGGAGCACATAGCCAGTGAGGG - Intergenic
1092543964 12:9437280-9437302 CGGGAGCACATAGCCAGTGAGGG + Intergenic
1094508983 12:31084770-31084792 CGGGAGCACATAGCCAGTGAGGG - Intronic
1102567891 12:113808979-113809001 GGGCAGCAGAGAGCCCCTGAAGG - Intergenic
1113789032 13:113017630-113017652 CGGGAGGGGAGCCCCCTTGAGGG - Intronic
1117249540 14:53922734-53922756 GGGGAGCAGAGCGATTGTGAAGG + Intergenic
1126701705 15:51373686-51373708 CTGGAGCAGAGTGACAGTGATGG + Intronic
1130979560 15:88803371-88803393 GGGGAGGGGAGGGCCCGTGAGGG - Intergenic
1132947558 16:2540251-2540273 GGGGAGCAGTGCGAGCGTGAAGG + Intronic
1132968182 16:2671372-2671394 GGGGAGCAGTGCGAGCGTGAAGG - Intergenic
1136556555 16:31010648-31010670 CGGGAGCCGAGCGCGGGGGAGGG + Intergenic
1142904640 17:3033755-3033777 TGGGAGCAGAGCCTCGGTGAGGG + Exonic
1143629008 17:8126545-8126567 CGGGATCAAAGCGGCCGGGAAGG - Intergenic
1144675885 17:17161321-17161343 CGGGAGCAGAGCGCCCGTGAGGG + Exonic
1146283232 17:31558840-31558862 CGGGAGCGGAGCGGCCGGCAGGG + Intergenic
1148590981 17:48816785-48816807 CCGGAGCCGAGGGACCGTGAGGG + Intronic
1152019757 17:77774524-77774546 AGGGAACAGAGCATCCGTGATGG + Intergenic
1152667539 17:81580039-81580061 CAGGAGCATAGCGCCCTGGAAGG - Intronic
1156331604 18:36129075-36129097 CGGGAGCAGGGCGGCTGGGAGGG - Intronic
1156584395 18:38415814-38415836 CTGGAGCAGTCTGCCCGTGAAGG - Intergenic
1160570829 18:79816455-79816477 AGGGAAAAGAGCGCCCGTGCAGG - Intergenic
1163144806 19:15373158-15373180 CGGGAGCGGGGCTCCCTTGATGG - Exonic
1167126941 19:47555922-47555944 AGGGAGGAGAGAGCCCTTGATGG + Intergenic
925188462 2:1865070-1865092 CGGGGGAAGGGCGCCCGTGTGGG + Intronic
925594608 2:5543082-5543104 TGAGAGCAGAGCCCCCATGATGG + Intergenic
925815924 2:7748803-7748825 CGGCTGCAGAGCGTCTGTGACGG - Intergenic
926126899 2:10277534-10277556 CGGGAGCAATGGGCCCGGGAAGG + Intergenic
932316693 2:70789621-70789643 AGGGAGCAGAGCGCACGTTCAGG - Intronic
932758643 2:74425544-74425566 GGGGAGCAGAGGGCTCGTCAGGG - Intronic
947636073 2:231681264-231681286 CCGGAGCGGGGCGCCCGGGAAGG - Intergenic
948288203 2:236803724-236803746 CGGGAGCAGAGGGGCTGTGCTGG - Intergenic
1170168504 20:13385487-13385509 CAGGAGGAGAGCCCCAGTGAGGG + Intergenic
1171346444 20:24469600-24469622 GGGGAGCAGAGCGGCGCTGAGGG + Exonic
1174360041 20:50023271-50023293 CGGGAACAGAGAGCCCGTCTTGG + Intergenic
1176415267 21:6471109-6471131 CAGGAGCAGAGCCCCCAGGAGGG + Intergenic
1179690767 21:43079442-43079464 CAGGAGCAGAGCCCCCAGGAGGG + Intergenic
1180216331 21:46325365-46325387 CAGGAGCAGAGCTCCCAGGAGGG + Intronic
1182475588 22:30574746-30574768 CGGGCGCAGAGGGGCCGGGATGG - Intergenic
1183546073 22:38455402-38455424 CGGGGGCAGAGCGCGCGAGCAGG - Intergenic
1183588519 22:38767044-38767066 CCGGAGCAGAGGGCCAGGGAGGG - Intronic
1184792065 22:46706272-46706294 CGGGAGCAGACGGCTCGGGAGGG - Intronic
1185043185 22:48516017-48516039 CGGGTGCTGAGCGGCGGTGAAGG - Intronic
953626822 3:44578885-44578907 CGGGAGCAGAGCGCCCGTGAGGG - Intronic
960864358 3:122184555-122184577 CGGGAGGAAAGCGCCCCTGGTGG + Intronic
969326006 4:6444253-6444275 CGGGAGCAGACCTCCTGTAATGG - Intronic
969584335 4:8083399-8083421 AGGGAGCAGGCCACCCGTGAGGG - Intronic
973293206 4:48490276-48490298 CGGGAGCAGTGCGCCCATGGCGG + Exonic
985518543 5:359311-359333 CTGGGGAAGAGCGCCCGCGAGGG + Intronic
985660972 5:1156290-1156312 CGGGACCAGGGGGCCGGTGAGGG + Intergenic
986162096 5:5239485-5239507 TTGGAGCAGAGCCCCTGTGATGG - Intronic
986404898 5:7416010-7416032 GGGGAGAAGAGAGCCAGTGAGGG + Intronic
988200912 5:28067041-28067063 CGGGAGCAGGGCACCCCTGCTGG - Intergenic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
992866279 5:80960389-80960411 CGGGAGCCGAGCCCCCGCGGCGG - Intergenic
997360229 5:133290372-133290394 TGGGGGCAGAGCTCCTGTGAGGG + Intronic
1015995040 6:138988288-138988310 CGGGAGGAGAGAGCGCGAGAGGG + Intergenic
1018859450 6:167699905-167699927 CGGGAACAGAGCGCCAGTCAGGG + Intergenic
1018949405 6:168369331-168369353 CTGGAGCAGAGCCCACGTGACGG + Intergenic
1019112696 6:169729704-169729726 CGAGAGCAGAGTCCCCATGATGG + Intergenic
1019303654 7:322280-322302 TGGCAGCAGAGCGCCAGGGATGG + Intergenic
1019656429 7:2198510-2198532 CCGGAGCAAGGAGCCCGTGATGG + Intronic
1023983389 7:45082141-45082163 CGGGGGCTGAGAGCCCTTGAGGG + Exonic
1024623986 7:51188548-51188570 CTGGAGCAGAGCCCCCATGGTGG + Intronic
1030553668 7:110996359-110996381 CGGGAGCAGAGAGAACGAGAGGG + Intronic
1031970320 7:128060338-128060360 CCAGAGCAGAGGGTCCGTGAAGG + Intronic
1033771991 7:144563184-144563206 AGGTAGCAGAGCTCCCTTGAAGG + Intronic
1036524098 8:9519094-9519116 CGGGAGCAGAATGCCCTTGAAGG + Intergenic
1039369735 8:36972614-36972636 AGGGAGCAGAGCTGGCGTGAAGG + Intergenic
1041648807 8:60281218-60281240 CCGGAGCGGAGCGCGCGTGGGGG + Exonic
1045063470 8:98426991-98427013 CGGGAGCAGAGCGGGTGTGACGG - Intronic
1049353495 8:142176659-142176681 CGGGGGCAGGGAGCCCGTGTTGG - Intergenic
1049649928 8:143761155-143761177 CCGGAGCCGCGCGCCCGAGAAGG + Intergenic
1050325114 9:4490803-4490825 TGGGCGCAGAGAGCGCGTGAGGG - Intronic
1057314645 9:93960559-93960581 CGGGGGGAGAGCGCCTGTGCGGG - Intergenic
1057748460 9:97771143-97771165 CAGGAGCAGAGCTTCCCTGAGGG - Intergenic
1057863672 9:98662555-98662577 GGGGAGCAGAGCTCCAGAGAAGG + Intronic
1061620275 9:131807320-131807342 CTGGAGGAGAGCGCCGGTGGGGG + Intergenic
1185877740 X:3713704-3713726 CGGGGGCGGAGCGCGCGCGAAGG - Intergenic
1190622768 X:52304661-52304683 CAGGAGCAAAGCTCCTGTGAAGG + Intergenic
1190633992 X:52416961-52416983 CAGGAGCAGAGCCCCTGAGAAGG + Intergenic
1190678729 X:52805667-52805689 CAGGAGCAGAGCCCCTGAGAAGG + Intergenic