ID: 953627373

View in Genome Browser
Species Human (GRCh38)
Location 3:44581813-44581835
Sequence ATTTAGAAGCTGAATGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 1, 2: 5, 3: 53, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953627373_953627377 4 Left 953627373 3:44581813-44581835 CCCTGGTCATTCAGCTTCTAAAT 0: 1
1: 1
2: 5
3: 53
4: 357
Right 953627377 3:44581840-44581862 TAGGAAATGTCAAGAGATGGTGG 0: 1
1: 0
2: 2
3: 11
4: 282
953627373_953627376 1 Left 953627373 3:44581813-44581835 CCCTGGTCATTCAGCTTCTAAAT 0: 1
1: 1
2: 5
3: 53
4: 357
Right 953627376 3:44581837-44581859 CAGTAGGAAATGTCAAGAGATGG 0: 1
1: 0
2: 1
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953627373 Original CRISPR ATTTAGAAGCTGAATGACCA GGG (reversed) Intronic
900016613 1:154974-154996 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
900046874 1:513566-513588 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
900069078 1:755284-755306 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
901284181 1:8063501-8063523 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
901597949 1:10399675-10399697 ATTCTGAACATGAATGACCACGG + Exonic
901902416 1:12376591-12376613 ATTTACAAGCTGAATGACCTTGG - Intronic
902345012 1:15809998-15810020 TTTTTGAAGCTAAATGACCTGGG + Intergenic
903772819 1:25774696-25774718 ATTTAGGAGCTAGATGACCTTGG - Intronic
905117811 1:35657668-35657690 AATTAGAAGCTGTTTGGCCATGG - Intergenic
905319949 1:37108780-37108802 CTTGGGAAACTGAATGACCAAGG + Intergenic
905563208 1:38943289-38943311 ATTTAAAAACTGGCTGACCATGG - Intergenic
905591608 1:39168650-39168672 ATTTATCAGCTGAGTGACCTGGG + Intronic
905620550 1:39442183-39442205 ATGGAGAAGCTTAATCACCAGGG + Exonic
905842855 1:41199573-41199595 ATTTAGAAGTTGAGTGACCATGG - Intronic
905967851 1:42114337-42114359 ATTTAGTAGATGAATGACTTTGG + Intergenic
905975971 1:42173703-42173725 ACTTACAAGCTGGATGACCTTGG + Intergenic
906044597 1:42818012-42818034 ACTTAGAAGCTGTGTGACCCGGG - Intronic
906975789 1:50571377-50571399 ATTTAGCAGCTGTGTGACCATGG + Intronic
907148734 1:52261978-52262000 ATTTACTAGCTGTATGACCCTGG + Intronic
908335881 1:63122829-63122851 ATTTAGATGCTGTGTGACCTTGG - Intergenic
908440188 1:64145910-64145932 ATTTACTAGCTGGATGACCCTGG - Intronic
908469117 1:64424842-64424864 ATTTGCCAGCTGTATGACCATGG - Intergenic
909317200 1:74238266-74238288 ATTTATAAGCTGTATATCCATGG + Intronic
909578539 1:77204616-77204638 ATTTTAAAGCTGGATGTCCAGGG - Intronic
909918883 1:81355719-81355741 ATTCAGAAGCTGCAGGCCCAGGG - Intronic
910176512 1:84436500-84436522 ATTTACTAGCTGAGTGACCTTGG - Intergenic
910437911 1:87224482-87224504 ACTTACAAGCTGTATGACCTTGG + Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
910692828 1:89982137-89982159 TTTTATTAGCTGAATGACCTTGG + Intergenic
910724631 1:90325788-90325810 ATTTAATAGCTGAATGACCTTGG - Intergenic
911167717 1:94739404-94739426 ACTTTCAAGCTGAATGATCAGGG + Intergenic
911339614 1:96620837-96620859 ACTTATTAGCTGAATGACCTTGG + Intergenic
913475152 1:119229981-119230003 ATTTAGAAGCTGCATGAGTGAGG - Intergenic
913617023 1:120571085-120571107 ATTTATTAGCTGTATGACTATGG - Intergenic
914461028 1:147885319-147885341 ATTGAGAAGATGCATGCCCAGGG - Intergenic
914573253 1:148939830-148939852 ATTTATTAGCTGTATGACTATGG + Intronic
916571748 1:166034119-166034141 TTTTAGCAGCTGAATAACCTTGG + Intergenic
917783112 1:178421098-178421120 ATTTACTAGCTGTATGACCCTGG - Intronic
918145640 1:181753445-181753467 ACTTAGAAGCTATATGACCCAGG + Intronic
919259493 1:195173771-195173793 ATTTAGAAACTGAATGACTTGGG + Intergenic
919481639 1:198097213-198097235 AGTAAGAAGCTGAAAGACAAAGG + Intergenic
919798076 1:201333240-201333262 ATTTACAAGCTGTGTGACCCTGG - Intergenic
920233719 1:204488123-204488145 ACTTACAAGCTGTATGACCTTGG - Intronic
920461207 1:206141736-206141758 ATTTAAAACCTAAATGCCCAAGG - Intergenic
920572337 1:207027032-207027054 ACTTATAAGCTGTATGACCTTGG - Intronic
921215024 1:212929240-212929262 AATAAGAAACTAAATGACCACGG - Intergenic
921601359 1:217109980-217110002 AATTAGAAGCTAAATAAACAGGG - Intronic
922228577 1:223666519-223666541 AGTTACAAGCTGTATGACCTTGG + Intergenic
922915862 1:229257205-229257227 ACTTAGTACCTGAATGACCTTGG - Intergenic
923958057 1:239044826-239044848 ATTTAGAGGCCGAGAGACCAAGG + Intergenic
924240222 1:242033122-242033144 AATTAGAGGCTGGAAGACCAAGG + Intergenic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1065376548 10:25049063-25049085 ATTTGCTAGCTGAGTGACCAGGG + Intronic
1066360078 10:34721558-34721580 AGTGATAAGCTGAGTGACCAGGG + Intronic
1067269778 10:44780399-44780421 ACTTACAAGCTGAATGACCTTGG - Intergenic
1067284371 10:44896802-44896824 ATTTACCAGCTGCATGACCTTGG - Intergenic
1067394335 10:45899735-45899757 TCTCAGAAGCTGAATGACCATGG - Intergenic
1067862659 10:49868866-49868888 TCTCAGAAGCTGAATGACCATGG - Intronic
1068441304 10:57058105-57058127 ATTCAGAACCTGAATTAGCAAGG - Intergenic
1068747531 10:60551157-60551179 ATTTAGAATCTGAATATTCAAGG + Intronic
1069864126 10:71490859-71490881 TTTTACAAGCTGAGTGACCTTGG - Intronic
1070078510 10:73162318-73162340 ATTTAGCATCTGACTGAACATGG + Intronic
1070694292 10:78550676-78550698 ATTTAGAAGCTGTGTGACCTTGG - Intergenic
1070967862 10:80540548-80540570 ATGTAGCAGCTGGATGACCTTGG - Intronic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1072267694 10:93746182-93746204 ATTTAGCAGCTGAGTGACCTTGG - Intergenic
1072700296 10:97636085-97636107 ATTTACCAGCTGAATGACCATGG + Intronic
1074678722 10:115881785-115881807 ATTTAGAAGCAGACAGACCTGGG - Intronic
1075535831 10:123271402-123271424 ATTCTGAAGGTGAAAGACCAAGG - Intergenic
1076025516 10:127108879-127108901 ATTTACCAGCTGAATTATCATGG - Intronic
1076218016 10:128711308-128711330 ATTTTGGAGCTGTCTGACCAGGG + Intergenic
1076973204 11:150043-150065 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
1078920066 11:15821944-15821966 AATATGAAGATGAATGACCATGG - Intergenic
1079145971 11:17852210-17852232 ACTTAGTAGCTGAATGACCTTGG - Intronic
1079817689 11:25083061-25083083 ATTTAGAGGCTGAAGCAGCAAGG + Intergenic
1080556321 11:33420682-33420704 AAAGAGAAGCTGAATGGCCATGG + Intergenic
1080925526 11:36752209-36752231 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1081794399 11:45809682-45809704 ATTTAGAAGCTGAGTGGCCTGGG - Intronic
1083242749 11:61401598-61401620 ATTTCTAAGCTGAATGCCCTTGG - Intergenic
1084904826 11:72337574-72337596 ATTTATCTGCTGTATGACCATGG - Intronic
1085914812 11:80873027-80873049 ATTTAGAATTTGTATGACCTTGG + Intergenic
1086051617 11:82598595-82598617 ATTTATTAGCTGAGTGACCTTGG + Intergenic
1086270013 11:85051694-85051716 ATTTAGCAGCTGTATAACCTTGG + Intronic
1086630814 11:89017602-89017624 AAGCAGAAGCTGAATGGCCAAGG + Intronic
1087175967 11:95095776-95095798 ATCTAGAAGCTGTTTGACCTTGG - Intronic
1087204960 11:95384654-95384676 ATTTACTAGCTGTATGACCTTGG + Intergenic
1087479307 11:98679918-98679940 ATTTAGAATCTGGATGAAAAAGG - Intergenic
1087496857 11:98902388-98902410 ATTTAGAAGCTCTATTACTATGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088752032 11:112852049-112852071 ATTTATAAGCTGCATGACCTTGG - Intergenic
1091009722 11:131988241-131988263 ATGTTGAAACTTAATGACCAAGG - Intronic
1091644657 12:2264489-2264511 AGTTAGAAGCTTCATGACCTAGG + Intronic
1092704204 12:11266766-11266788 ATTTAGCTGCTGAAAGATCAGGG + Intronic
1092708198 12:11307813-11307835 ATTTAGCTGCTGAAAGATCAGGG + Intronic
1092974418 12:13730532-13730554 ACTTGTTAGCTGAATGACCATGG - Intronic
1093063557 12:14632646-14632668 TTTTATAAGCTCAATGAACAAGG - Intronic
1094182829 12:27610185-27610207 ATTTAGAAGCTGAACGATTATGG + Intronic
1095144260 12:38705741-38705763 ATTTTGAATCTGAATGAACTGGG + Intronic
1096540605 12:52304877-52304899 ATCTAGAGGCTGGATCACCAGGG + Intronic
1098084794 12:66830750-66830772 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
1098407288 12:70139948-70139970 ATTTTTAAGCTGAATGACGATGG + Intergenic
1098531683 12:71548729-71548751 TTCTAGAAGCTGTATGACCTTGG - Intronic
1098958567 12:76714063-76714085 ATTTAGAAGCTGGAAAAGCAAGG - Intergenic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1104141931 12:125995940-125995962 ATTTATGAGCTGCATGACCTTGG + Intergenic
1106092483 13:26609693-26609715 ATTTGGAACCTGAGTGAACAAGG + Intronic
1106681269 13:32010956-32010978 ATTGAGAAGCTGCATGCACAGGG - Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1109081101 13:57902764-57902786 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
1111230395 13:85337961-85337983 TTTTTGAAACTGAATAACCAAGG - Intergenic
1111397571 13:87685062-87685084 ATTTAGAAGCTCTGTGCCCAAGG + Exonic
1111657192 13:91168415-91168437 ATTTACAAACTGTATGACCTTGG - Intergenic
1112123530 13:96439558-96439580 ACTTAGCAGCTGTGTGACCATGG + Intronic
1112210282 13:97370192-97370214 ATTTAGAAGCTGTCTGACTTTGG - Intronic
1113128056 13:107002336-107002358 ATTTATAAGCTGAATAAACTTGG - Intergenic
1113339285 13:109406130-109406152 ATTTACAAACTGTATGACCATGG - Intergenic
1113704426 13:112417546-112417568 TTTTAGAAATTGAATGACAAAGG - Intronic
1113964199 13:114143261-114143283 ATTTAGAAGCTGAGTACACAAGG - Intergenic
1114799933 14:25761979-25762001 ATTTAGAAGTTGATTGAATATGG - Intergenic
1115526373 14:34284473-34284495 ATTTACAAGCTGGAGGATCAGGG - Intronic
1116117382 14:40672525-40672547 ATTCTGTAGCTGAATTACCAAGG + Intergenic
1116427137 14:44805117-44805139 ATTCAGAAGCTGGAAGTCCAAGG - Intergenic
1116694678 14:48157673-48157695 AATTAGCAGATAAATGACCATGG + Intergenic
1117437068 14:55726310-55726332 ATTTATATGGTGAATTACCATGG - Intergenic
1117803951 14:59470808-59470830 ATCTAGAAGCTTAAATACCAAGG + Intronic
1117831862 14:59759357-59759379 ATTTACAAGCTGTGTGACCCTGG + Intronic
1117946124 14:61023770-61023792 CTTTAAAAGCAAAATGACCATGG + Intronic
1118426631 14:65671478-65671500 ATTTATAAGCTGTATGACCCTGG - Intronic
1118603612 14:67487477-67487499 AATTTGAAGCTGAATGAGAATGG - Intronic
1118732183 14:68676268-68676290 ATGTACCAGCTGAATGACCCAGG - Intronic
1119173008 14:72548912-72548934 GTTTAGAAGCTGAATGGCCAAGG + Intronic
1119576271 14:75725560-75725582 ATTTATTAGCTGCATGACCTAGG - Intronic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1120477482 14:85006638-85006660 ATTTATAAGCTGTGTGAACATGG + Intergenic
1120930773 14:89846005-89846027 ATTTACAAGCTGAGTGACCTTGG + Intronic
1121898307 14:97669670-97669692 ATTTAGCAGCTAAGTGACCTGGG - Intergenic
1122243910 14:100387674-100387696 ATTTACTAGCTGTGTGACCACGG - Intronic
1122756811 14:103987376-103987398 ATTTGGAAGATGAATGAACAAGG - Intronic
1124395539 15:29297947-29297969 ATCTAGCAGCTGAATGCACATGG + Intronic
1125433517 15:39622698-39622720 GTTTAGAAGCTATATGACCTTGG - Intronic
1125556878 15:40593188-40593210 ATTTAGAAGCTGTATAACCTCGG + Intergenic
1126354157 15:47777178-47777200 ATTTAGAACCTGCATCAGCATGG - Intergenic
1128773251 15:70299701-70299723 ATTTATAAGCTGTGTGACCTTGG + Intergenic
1129229226 15:74187470-74187492 ACTTACAAGCTGAGTGACCTTGG - Intronic
1130866385 15:87936484-87936506 ATGAAGATGCTGAATGACCCAGG - Intronic
1133697522 16:8279004-8279026 ATTTAAAATCTGAAATACCATGG + Intergenic
1133846879 16:9463074-9463096 ATTTAGCTGCTCAATGAACATGG + Intergenic
1133923182 16:10172772-10172794 AATTAGAAGTTGAAAGATCAAGG + Intronic
1134569635 16:15280244-15280266 ATTTATCAGCTGAATGATCTTGG - Intergenic
1134732744 16:16475805-16475827 ATTTATCAGCTGAATGATCTTGG + Intergenic
1134749017 16:16611066-16611088 ACTTACAAGCTGAATGACCTTGG + Intergenic
1134934698 16:18236163-18236185 ATTTATCAGCTGAATGATCTTGG - Intergenic
1134996448 16:18742570-18742592 ACTTACAAGCTGAATGACCTTGG - Intergenic
1135717747 16:24787040-24787062 ATTTACTAGCTGTGTGACCATGG - Intronic
1135947775 16:26880099-26880121 ATTACTAAACTGAATGACCAAGG - Intergenic
1137736513 16:50728139-50728161 CTTCAAATGCTGAATGACCATGG + Intronic
1137843608 16:51665121-51665143 ATTTGGAGTCTGAAAGACCAAGG + Intergenic
1140232409 16:73128457-73128479 ATTTATAAGCTGTGTGACCATGG - Intronic
1141061668 16:80878408-80878430 ATTTATAAGCTGTGTGACCTTGG + Intergenic
1142447047 16:90147483-90147505 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
1142460445 17:87848-87870 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
1142630578 17:1223512-1223534 ACTTATAAGCTGGGTGACCATGG + Intronic
1146299612 17:31677946-31677968 AGTCAGAAGCTGAAGGAGCAGGG + Intergenic
1146976615 17:37118678-37118700 ATTTTGTAGCTGAATGAGCTTGG + Intronic
1148903564 17:50896929-50896951 ATTTAGCAGCTGAATAATCACGG + Intergenic
1150272534 17:63875957-63875979 ATTTAGAAGCTGAAATAACTGGG - Intronic
1150278177 17:63913235-63913257 ATTTAGAAGCTGAAATAACTGGG - Intronic
1151054548 17:71016517-71016539 ATTTAAAAGCAAAATGTCCATGG - Intergenic
1151110637 17:71673606-71673628 ATTTACTAGCTAAATGACCTTGG - Intergenic
1151263809 17:72938024-72938046 ATTTTGAAGCTGGATGTTCAGGG - Intronic
1152155175 17:78628489-78628511 AACTAGAAGCTGAATGACCTTGG - Intergenic
1154053569 18:10988233-10988255 TTTTGGAAGCAGAAAGACCAGGG + Intronic
1155882264 18:31163880-31163902 ATTTGGAAAATGAATGACCCAGG + Intergenic
1156115263 18:33779916-33779938 ATTTAGTAGCTGAATGCCCTTGG + Intergenic
1156585616 18:38427821-38427843 CTTTAGAAGCTGGATGACCTTGG - Intergenic
1156597877 18:38568600-38568622 AATTAGAAGCTGTGTGACCTTGG - Intergenic
1156830468 18:41485246-41485268 ATTTACCAGCTGCATGACCTTGG - Intergenic
1157332068 18:46711394-46711416 ATTTACTAGCTGAATGACCTTGG - Intronic
1157343736 18:46804385-46804407 AATTACAAGCTGCATGACCCTGG + Intergenic
1159161686 18:64650502-64650524 ATTTAGGAGCTGTGTGACCTTGG - Intergenic
1160650160 19:220348-220370 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
1162010353 19:7809712-7809734 ACTTACAAGCTGTATGACCATGG + Intergenic
1164339365 19:24372352-24372374 ATTTTAAAGCTGAGTGTCCAGGG - Intergenic
929093421 2:38241800-38241822 ACTTAGAAGCTGAGTGACTTTGG - Intergenic
929969107 2:46558472-46558494 AAATAGAAGCTGAAAGACAATGG - Intronic
930501755 2:52229947-52229969 ATTTGGAAGTTTATTGACCAAGG - Intergenic
930884919 2:56314598-56314620 ATTCTGAAACTGATTGACCATGG + Intronic
931260206 2:60611269-60611291 ATTTATAAACTGAGTGACCTAGG + Intergenic
931676037 2:64697302-64697324 ATATAGCAGCTGAATGACTTTGG - Intronic
932821026 2:74900790-74900812 AGTTAGTAGCTGAATGGCAACGG - Intergenic
933239548 2:79904597-79904619 ATTTGTGAGCTGAATGACCATGG + Intronic
933279287 2:80314960-80314982 ATTTAGAAGCTGTGTGATCTGGG + Intronic
933455081 2:82509248-82509270 ATTTGTAAGATGCATGACCAGGG - Intergenic
933610587 2:84430368-84430390 ACTTAGAAGCTATATGACCTTGG - Intronic
934510651 2:94938769-94938791 TCTCAGAAGCTGAATGACCATGG - Intergenic
934602722 2:95670443-95670465 ACTTAAAAGCTGCATGACCTAGG + Intergenic
934955726 2:98616744-98616766 ATTTTCTAGCTGCATGACCATGG - Intronic
935100522 2:99990939-99990961 GTTTAGATGCTGAACCACCATGG + Intronic
935496005 2:103782596-103782618 AGTTATAAGCTGAAAAACCAAGG + Intergenic
936536102 2:113312635-113312657 ACTTAAAAGCTGCATGACCTAGG + Intergenic
938872846 2:135499144-135499166 ATTTTAAAGCTGGATGTCCAGGG - Intronic
940115326 2:150202226-150202248 ATTTACAAGCTGTGTGACCCTGG - Intergenic
942209834 2:173659364-173659386 ATTTAACAGCTGATTGACTATGG - Intergenic
943917744 2:193658938-193658960 TTTTAAAAGCTGAAAGACCTGGG + Intergenic
943928097 2:193813935-193813957 ATTTAGAAGCTGAAGTTCTAAGG - Intergenic
943928823 2:193822896-193822918 TTTTAGAAATTGAATGGCCAAGG + Intergenic
944138145 2:196423344-196423366 AATGACTAGCTGAATGACCATGG - Intronic
945873406 2:215252243-215252265 ATTTACTACCTGAATCACCAAGG - Intergenic
946550636 2:220798009-220798031 ATTTACAATCTCCATGACCATGG + Intergenic
946583014 2:221151035-221151057 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
1170015963 20:11782632-11782654 ATTTTGAAGTTGAACGACCAGGG - Intergenic
1170052742 20:12164668-12164690 ACTTAGAAGTTGAGTGACCATGG - Intergenic
1170988992 20:21285032-21285054 ATTTATCAGCTGAGTGACCTTGG + Intergenic
1170991677 20:21307083-21307105 ATTTATCAGCTGAGTGACCTTGG - Intronic
1172441254 20:34968171-34968193 ATTTACAAGCTGAGTGACCCTGG - Intergenic
1173034782 20:39398282-39398304 ATCTATAAGCTGAAGGCCCAAGG - Intergenic
1173359682 20:42331249-42331271 AGTTAGGAGCTGAATCCCCATGG - Intronic
1173534777 20:43801124-43801146 CCTTACTAGCTGAATGACCATGG - Intergenic
1173701645 20:45077118-45077140 ATTTACTAGCTGCATGACCTTGG - Exonic
1173711751 20:45163542-45163564 AGTGAGTAGCTGAATGACCTTGG - Intergenic
1173957154 20:47042514-47042536 GGTCAGAGGCTGAATGACCAGGG - Intronic
1174575172 20:51532258-51532280 ACTTAGAAGCTGTGTGACCTTGG - Intronic
1174849145 20:53975005-53975027 AGTAAGAAGCTGGATCACCATGG + Intronic
1175675341 20:60941952-60941974 ATTTAGAATCTGAGTGATCCAGG + Intergenic
1175990891 20:62788484-62788506 CTTTAGAAGCTGAATGAATGGGG + Intergenic
1176917092 21:14638816-14638838 ACTTAGAAGCTATATGACCTTGG - Intronic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1182386034 22:29942186-29942208 ATTTTAAAGCTGAATGTCTAGGG + Intronic
1182874184 22:33675893-33675915 ACTTACCAGCTGAATGACCTTGG - Intronic
1184410597 22:44323832-44323854 ATTTAAAAGCAGAAACACCAAGG - Intergenic
949444649 3:4120847-4120869 ATTTACTAACTGTATGACCATGG + Intronic
949500348 3:4674121-4674143 CTTTTGAAGCTGAGTGACCCAGG + Intronic
949977145 3:9471322-9471344 ATTTACTAGCTGTGTGACCACGG - Intronic
951421337 3:22489384-22489406 TTTAAGATGCTGAATAACCATGG - Intergenic
951530269 3:23692421-23692443 ATTTTGAGGCTGCAGGACCATGG + Intergenic
952177999 3:30887716-30887738 TTTTACAAGCTGAATGGCCCTGG + Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
955025191 3:55160750-55160772 TTTGAGAGGCTGGATGACCATGG + Intergenic
956291004 3:67659732-67659754 ATTTAAAAGCTCCATGACCCTGG + Intergenic
957291651 3:78284481-78284503 ATTTACTAGCTGAGTGACCTAGG + Intergenic
957724039 3:84041792-84041814 ATTTAAAAGCTGCATGATCTTGG - Intergenic
957756298 3:84492439-84492461 ATTTTAAAGCTGAATGTCCAGGG - Intergenic
958975027 3:100657850-100657872 ATTTCTAATCTGAATGACCTAGG - Intronic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
959861911 3:111226099-111226121 TTTTAGAAGCTGGAAGAACAAGG - Intronic
959941173 3:112083189-112083211 ATTTAGAACCTGAATGATGTGGG + Intergenic
960270321 3:115666812-115666834 ATTCAGAAGCTGGATGACGCTGG + Intronic
960535762 3:118812992-118813014 ATTTATTAGCTGCATGACCTTGG - Intergenic
962158635 3:132976024-132976046 ATTTACTAGCTGCATGACCCTGG - Intergenic
962379524 3:134886427-134886449 ATTTATAAGCTGGGTGACCTTGG - Intronic
962486602 3:135849441-135849463 ATTTAGAAAAGGAAAGACCAAGG - Intergenic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
963212419 3:142707942-142707964 ATTTAGTATCTGTGTGACCATGG + Intronic
964704984 3:159608706-159608728 TTTTAGGACCTGAATGACCATGG + Intronic
968367687 3:198199781-198199803 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
969324826 4:6436591-6436613 AATTTGGAGCTGAATGACCAGGG - Intronic
970104624 4:12567401-12567423 ATTTACATGCTGTATGACCTTGG + Intergenic
971306243 4:25484221-25484243 AATTAGAAGGTGAATCACAAGGG + Intergenic
972258872 4:37387999-37388021 ACTTATGAGCTGAATGACCTTGG + Intronic
972286103 4:37649968-37649990 ATTTAGCAGCTGTGTGACAATGG + Intronic
972423175 4:38909169-38909191 ACTTAGTAGCTGAGTGACCTTGG + Intronic
972500052 4:39669570-39669592 ATTTACTAGCTGCATGACCTTGG + Intergenic
972751049 4:41989858-41989880 AGTTAAGAGCTGAATGAGCATGG + Intergenic
973248319 4:48034519-48034541 ATTTAGAATATGTATGCCCATGG - Intronic
973764504 4:54150875-54150897 AGTTGGAAGCTAAATGACCTTGG + Intronic
974512897 4:62868030-62868052 ATTTAGAGGCTCAATGTCCTTGG - Intergenic
974572085 4:63665955-63665977 AAATAGAGGCTGAATAACCAAGG - Intergenic
974686486 4:65237948-65237970 ATTTAGAAGCTGAATGACCTGGG - Intergenic
975668699 4:76758401-76758423 GTTTAGAAGCAGAATGGTCATGG + Intronic
976080391 4:81348275-81348297 ATTTAGAAGCAGACTGGCCTAGG - Intergenic
976080679 4:81351451-81351473 ATTTAGAAGCTGACTGGCCTGGG - Intergenic
978467590 4:109025883-109025905 TTTTAGAAGCTGTTTGACTAAGG - Intronic
979075478 4:116264546-116264568 ATTTTGTAGTTGAGTGACCATGG - Intergenic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
980678481 4:136123601-136123623 ATTTAGTAGAGGAATGACTAGGG - Intergenic
981728909 4:147876918-147876940 ATTTAGTAGTTGTATGACCTAGG - Intronic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
983034087 4:162840636-162840658 ATTTAAAAGCTAAATAACAATGG + Intergenic
983861146 4:172708502-172708524 ACTTACTAGCTGAATTACCAAGG + Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
984523576 4:180829593-180829615 ATTTAAAACCTGAATACCCAGGG + Intergenic
984980764 4:185278376-185278398 TTTTTGAAGCTGCATGACCTTGG + Intronic
985385757 4:189446438-189446460 ATATAGAATTTGAATCACCATGG - Intergenic
987257622 5:16172765-16172787 ATTTAGAAAAGTAATGACCATGG + Intronic
989624401 5:43415570-43415592 ATTTTGAAGCTGGGTGTCCAGGG - Intergenic
992243907 5:74797926-74797948 ATATATAAGCTTAATGAGCATGG + Intronic
992606216 5:78459007-78459029 ATTTATAAGCTGTGTGACCTCGG + Intronic
993454242 5:88109157-88109179 ATTTAGAAGTTCAAGGTCCACGG + Intergenic
994303296 5:98172633-98172655 AATTAGAAGCTAAATTATCAGGG - Intergenic
995225643 5:109697600-109697622 AATTGGTAGATGAATGACCATGG - Intronic
995299102 5:110557339-110557361 ATTCAGAATCTGAATGGCCAAGG - Intronic
995683919 5:114750281-114750303 ATTGACTAGCTGAATGACCTTGG - Intergenic
995906701 5:117132873-117132895 AATTAGGAGCAGAATCACCAGGG - Intergenic
996021623 5:118596988-118597010 ATTTATTAGCTGTATGACCTTGG - Intergenic
998142491 5:139708110-139708132 ATTTACTAGCTGAGTGACCTTGG - Intergenic
998891241 5:146748182-146748204 ACTTACTAGCTAAATGACCATGG - Intronic
999269988 5:150291274-150291296 ATTTATTAGCTGAGTGATCACGG + Intergenic
999858172 5:155617755-155617777 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1000383353 5:160648748-160648770 AATTACAAGCTGTATGACCTTGG - Intronic
1001710009 5:173771105-173771127 ATCCTGAAGCTGAAGGACCACGG + Intergenic
1001827163 5:174754269-174754291 CTTTATTAGCTGAATGACCTTGG + Intergenic
1002208537 5:177581326-177581348 ACTTATCAGCTGAATGACCTTGG - Intergenic
1002726907 5:181305010-181305032 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
1003333775 6:5151689-5151711 ATTTACTAGCTGCATGACTAGGG + Intronic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1004039779 6:11964011-11964033 ATTTATAAGCTGGAGAACCAGGG - Intergenic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1006847396 6:37072166-37072188 AGTGTGAAGCTGAATGACAAAGG + Intergenic
1007278379 6:40692193-40692215 ATTTATGAGCTGCATGACTATGG - Intergenic
1007562378 6:42820793-42820815 ATTCAGATGCTGAATGATCTGGG - Intronic
1007967735 6:46017466-46017488 ATTTCCTAGCTGAATGACTAGGG - Intronic
1008170768 6:48202705-48202727 ATTTTAAAGCTGAGTGTCCAGGG - Intergenic
1011046574 6:83090291-83090313 ACTTAGCAGCTGTATGACCTTGG - Intronic
1012177629 6:96108354-96108376 ACTTACAAGCTGAATGACCTTGG + Intronic
1013082285 6:106823220-106823242 ACTTAGCAGCTGTGTGACCATGG + Intergenic
1015359584 6:132323278-132323300 ATTTACAAGCTGTAGGACCATGG - Intronic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1018448954 6:163887590-163887612 ATTTAGTAGAAGACTGACCAGGG - Intergenic
1018497861 6:164368641-164368663 ATAAAGAAGCTGAAAGAACAGGG - Intergenic
1018721795 6:166578421-166578443 ATGTAGGAGCTGGGTGACCAGGG + Intronic
1019837495 7:3403520-3403542 ATTTAGCAGCTTAATGACTTTGG + Intronic
1021009751 7:15447492-15447514 ATTCAGAAGCTGTGTGACCATGG + Intronic
1021031686 7:15745017-15745039 ATTTTCTAGCTGAGTGACCATGG + Intergenic
1021482280 7:21130867-21130889 ATTTAGAAGCTGGTTGACCATGG - Intergenic
1021899714 7:25272490-25272512 CTATAGAAGCTGAATCATCAAGG + Intergenic
1023565881 7:41523282-41523304 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
1025610330 7:63071812-63071834 ATTTAGGAGCTGCCTGACCTGGG + Intergenic
1026005786 7:66599346-66599368 ATTTAAAAGCTGGTTGGCCATGG - Intergenic
1026288061 7:68981074-68981096 CTTTGGAAGCTGAATGAACCAGG + Intergenic
1027834408 7:83221830-83221852 ATTTGGGAGATTAATGACCAGGG + Intergenic
1028265505 7:88719074-88719096 ATTTACCAGCTGAATGACCCTGG - Intergenic
1028305771 7:89262413-89262435 ATTTATTAGCTATATGACCATGG + Intronic
1028400908 7:90424376-90424398 ATTTTAAAGCTGAGTGTCCATGG - Intronic
1028420316 7:90625537-90625559 ATTTAAAAAATGAATGTCCAAGG - Intronic
1028656206 7:93210364-93210386 ATTTAATAGCTATATGACCATGG - Intronic
1030411965 7:109192131-109192153 ATTTACAAGCTGGGTGACCCTGG + Intergenic
1031513948 7:122679701-122679723 ATTTTAAAGCTGGATGTCCAGGG - Intronic
1032233710 7:130101074-130101096 ATTTAGCAACTGTATGACCTTGG + Intronic
1032739969 7:134729340-134729362 ATTTACTAGCTGGGTGACCATGG - Intergenic
1034040219 7:147870026-147870048 ATTTAACAGGTGAATGACTAAGG + Intronic
1035432610 7:158833632-158833654 ATGTTGAAACTGAATGGCCAAGG + Intergenic
1037591052 8:20312457-20312479 ACTTAGCAGCTGAGTGACCTTGG + Intergenic
1038115863 8:24554479-24554501 ATTTATAAGCTGCATAACAAAGG - Intergenic
1039695830 8:39910300-39910322 AGTTAGTAGCTGAATGGCAAAGG - Intronic
1041432646 8:57800617-57800639 ATTTACTAGCTGTATGACCTTGG - Intergenic
1041946269 8:63446456-63446478 GTTTATAAGCTGTATGACCTTGG - Intergenic
1043478066 8:80624819-80624841 ATTTACTAACTGTATGACCATGG - Intergenic
1044068556 8:87726612-87726634 ATTCAGAAGTAGAATCACCAAGG - Intergenic
1045943517 8:107767775-107767797 ACTTATAGGCTGTATGACCACGG - Intergenic
1046100818 8:109612105-109612127 ATTTACAAGCTGTGTGACCTTGG + Intronic
1046950726 8:120017304-120017326 ATTTACAAGCTGGGTGACCTTGG - Intronic
1047399966 8:124538191-124538213 ATTTAGCAGCTGAGTGTTCATGG - Intronic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1047504127 8:125465471-125465493 ACTTAGCAGCTGAGTGATCATGG - Intergenic
1048415422 8:134223029-134223051 ATTTACAAGCTGTATGACTTGGG + Intergenic
1048486430 8:134852071-134852093 ATTTAGAAGCTGTTTGATCTTGG + Intergenic
1050664268 9:7917636-7917658 ATTTGGTAGCTGAATGACCCTGG + Intergenic
1051092506 9:13426116-13426138 ATTTATAAACTGAGTGACTAAGG - Intergenic
1052237105 9:26224438-26224460 ATTTATTAGCTGAATAACCTTGG + Intergenic
1052356201 9:27507209-27507231 ACTTACTAGCTGTATGACCACGG - Intronic
1052370872 9:27663191-27663213 ATCTAGAAGATGAATGGCAAGGG - Intergenic
1052458706 9:28734552-28734574 ATTTAGCAGCTGTATGACCTTGG - Intergenic
1053654741 9:40205561-40205583 TCTCAGAAGCTGAATGACCGTGG + Intergenic
1053905131 9:42834776-42834798 TCTCAGAAGCTGAATGACCGTGG + Intergenic
1054366856 9:64351778-64351800 TCTCAGAAGCTGAATGACCGTGG + Intergenic
1054674485 9:67841520-67841542 TCTCAGAAGCTGAATGACCGTGG + Intergenic
1055010309 9:71558576-71558598 GTTTAGAAGATGCAAGACCAGGG + Intergenic
1055441051 9:76336836-76336858 ACTTACAAGCTGTATGACCTTGG - Intronic
1055508931 9:76975570-76975592 ATTAAGAAGCTGAATTATCAAGG - Intergenic
1055690399 9:78823923-78823945 GTTCTAAAGCTGAATGACCAAGG - Intergenic
1056347230 9:85709468-85709490 ATTGAGCAGCTGAATGACATTGG - Intronic
1056990024 9:91402145-91402167 ATTTAGAACTTGGATGAGCAGGG - Intergenic
1057693364 9:97306973-97306995 AGTTAGAAGCTGAAAGACTCTGG - Intergenic
1057821403 9:98333856-98333878 ATTTACCAGCTGTGTGACCATGG + Intronic
1058373863 9:104301123-104301145 AATTAGAAGCTGAAAGTCAATGG + Intergenic
1058434329 9:104948323-104948345 CTTGAGTAGCTGAATGACCGTGG + Intergenic
1058486863 9:105450422-105450444 ATTTATAAGCTGTATGAGCTGGG + Intronic
1058978222 9:110144895-110144917 ATTTTCAAGCTGAGTGACCTTGG - Intronic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059261945 9:112985538-112985560 ATTTAGAAGCTGGGTGGCCATGG + Intergenic
1059314589 9:113413200-113413222 ATTTAATAGCTGAGTGACCTGGG - Intronic
1059992728 9:119880449-119880471 GCTTAGAAGCTGGATGACCTTGG - Intergenic
1060139698 9:121199830-121199852 ATTTAGTAGTAGTATGACCACGG - Intronic
1060803912 9:126563259-126563281 ATTTAGTAGCTAAGTGATCATGG - Intergenic
1061561346 9:131405886-131405908 ACTTAGAAGCTGGGTGACCTGGG + Intronic
1062752028 9:138262486-138262508 ATTTTAAAGCTGGATGTCCAGGG + Intergenic
1186110309 X:6248131-6248153 GTTTAGAAGCTAAATTACCCTGG + Intergenic
1187660439 X:21540871-21540893 ATTTAGAATATGAATGTACAAGG - Intronic
1188467004 X:30493181-30493203 ACTTAGAAGATTATTGACCATGG + Intergenic
1188823612 X:34803320-34803342 ATTTTAAAGCTGGATGTCCAGGG - Intergenic
1189111673 X:38296899-38296921 GTTTATAAGCTGAGTGACCTTGG + Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189956889 X:46284903-46284925 ACTTAGAAGCTGCAAGACCTTGG + Intergenic
1190760847 X:53436831-53436853 ATTTACTAGCCGAATGACCCTGG + Intergenic
1190937753 X:55011892-55011914 ACTTAGAAGCTGTGTGACCTTGG + Intronic
1191682262 X:63853212-63853234 ATTTACCAGCTGTGTGACCATGG - Intergenic
1191682838 X:63858876-63858898 AATTATAAGCTGAGTGACAATGG - Intergenic
1191720985 X:64228462-64228484 ATTTAGTAGCTGTGTGACCTGGG + Intronic
1192089512 X:68138803-68138825 ACTTAGTAGCTGTATGACCTTGG - Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193174491 X:78376440-78376462 AATTGGAAGCTGAATGAATAAGG - Intergenic
1193838690 X:86380277-86380299 ATTTATAGGCTGTATGACCTTGG - Intronic
1194908965 X:99615347-99615369 ATTTAGAAGCAGTATGACACTGG - Intergenic
1195640350 X:107167840-107167862 ATTTTAAATCTGAATGATCAAGG - Intronic
1196003723 X:110813237-110813259 ATTTATAAGCTGTATGACTTTGG - Intergenic
1196640684 X:118056720-118056742 CTTTAGAAGCTTAATGACATAGG + Intronic
1196689510 X:118544337-118544359 ACTTACTAGCTGGATGACCATGG + Intronic
1197158983 X:123302504-123302526 ACTTAGAAGCTGGGTGACCTTGG + Intronic
1197652503 X:129081105-129081127 ATTTACTAGCTGTGTGACCATGG - Intergenic
1197821909 X:130549969-130549991 ATTCATAAGCTGTATGACCTTGG + Intergenic
1198473485 X:136972697-136972719 ACTTACTAGCTGAATGACCATGG - Intergenic
1200395177 X:155981832-155981854 ATTTTTAAGCTGAATGATGATGG + Intergenic
1201378790 Y:13349907-13349929 ATTTTGAAACTGAATCACCAAGG + Intronic
1201485979 Y:14495140-14495162 GTTTAGAAGCTGAATTACCCTGG - Intergenic